GenePrediction:GLEAN_845 Details

Name: GLEAN_845
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:350182..350775 (+ strand)
Length: 594
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:350182..350317 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_132:350389..350413 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_132:350507..350674 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_132:350730..350775 (+ strand)
Length: 46
>GLEAN_845 class=GenePrediction position=GCSC_132:350182..350775 (+ strand)
ATGTTCCGCACTGCCTTTGCCCGCCGTGCTGCGCCAGCCGCACGCCGCCTTTACTCGACCCCCGTCGGCGCCTCGGGCGA
GACCGCGTTCGTCCGCGAGCGCCGCGCCGTCAAGGAGCACGCCGGTGCCTCTGCTGGTGCGTTCCCGTCTCCATCCCTGC
CCCCGTCTGCTGTCCAATCGCAATGCCAATGCTGACCCCTGCCTCAGAGCTCTGGCGCAAGATCTCCATCTAGTAAGCCG
TTCCGTCACCCCTCCTGCAGCCGAGCAAGATGCAATTCCGCCGAGACAATCTCTTTGAGCGATTGTTTTTCTAACAGCAC
TGCAGCGGCACCATCCCCTGCCTCATTGGCGCCGGCATCAACGCCTACTTCCTGTGGAACGACCACTGGAACCACTGGAA
CCACATGCCCCCTCTGGAGGAGCGCACCGAGTACTCGTACCAGAACATCCGCACCCGGAACTTCCCCTGGGGTGACGGCG
ACAAGACCATCTTGTAAGTTGGCCCCTCTTTCCGCCCACCAATCGTTTGCTAACCCGTCCGATTGCAGCTGGAACCCCCA
GGTCAACTACCACAACAAGGACAAGCTCGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62