GenePrediction:GLEAN_846 Details

Name: GLEAN_846
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:357361..357917 (+ strand)
Length: 557
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:357361..357378 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_132:357448..357578 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_132:357658..357681 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_132:357842..357917 (+ strand)
Length: 76
>GLEAN_846 class=GenePrediction position=GCSC_132:357361..357917 (+ strand)
ATGTGCCGTTTCACGCAGGTATGGCCTTGGGTGCCTGTCCTCTTCTCCCATTACCCCCTGCCATAATTCTTACAGCGATA
AAAACAGACCGTCTACAGCTGCGACCACGAGCGCCTCGTGTACCACTGGATGTGCGACAACCTTCGCATCTCCGGTCGTC
GCTGCGTGAGCCATGCCAGCGACATCGAGGCCAAGTTTGTTGCTTTCCACGTCGTTAGGTGAGTCTTCTTGGAAGGCCTT
GGCCTGTCTGGCTTGCAGCGCTGAAATTCCCCATCTGTATCATACCTGTGCTGACAGCTACCTGAAGGCCCGATCCCTGT
CGTAAGTCCGGCCTTGTCGCCTTTCCCATCCGGCCTCTGGCCACCGTTGGGTCTCGTTTCCAAACGACGACGACTACTTC
CGTCCTTTGATATCCTCTAACTGTAATAAAAACAGCGAGCTGTCGGCCTTTCAAGTGGCCTTCTTGGATGTCCCATGTTA
GGACTAATGGCAAGGTCATAGGCTGCCATGGTTGGAAGGAGGACAGCGGCAGCGTCCCTCCGGACAAGTGTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62