GenePrediction:GLEAN_847 Details

Name: GLEAN_847
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:359634..360749 (+ strand)
Length: 1116
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:359634..359760 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_132:359812..360749 (+ strand)
Length: 938
>GLEAN_847 class=GenePrediction position=GCSC_132:359634..360749 (+ strand)
ATGGATAACCTTCCTGTCACGTCGGGAGAGGAGAAGATTGCTACAACGCCTTGCTCGACCACCGATTCTGGAGTAACCCT
CAACGAGGGACAAGCCCTGGCTCAGACCGGTGGTGAGGCTGCTCAAGGTGACTTTCCCCACCTCTTGCTTCCGTCAAGAG
CTGTGAACTAACGCCAAGCCAAAGAAGTGCCTACCGAAAGCGGCACCTACTCGGAAGTCACGACAACCCAGCCTGCACCT
ATGAATATGCCTGTGGACTCTGCTCCGGCACCGGTTGATACCGGGGGCTCTGAGGCATTCTCGTCCCTTCCTGCCAACAC
TGGTCAGCCCCCGTCTACACACTTCACGAATCCGATGCTTTTCTCGGCTCGAGAGGTAGTCGCCAGGCTGAGGGCCAGAT
CCCATGGCAAACCTCGGCATTTTTCCCGCCCGAGGGTGCGCCGTCGGAGCCGTGGACAACAGGGCATGCAACCAGTGTCT
AGACCTGATTCTCAGCCTTCGCCTGTGCAGGTTCCCTTTCCAAACGTGGGTTACTTTGTCGGGGCCATGCCCAACAGTAC
TCCGGCTTTCCAATATCCCGGCGGAATGGCAGTAGTGGCTCGTCCGTGGACTCATGCATATGCGCCATATAACGGCTTTC
AGCTGGGGGCACAGTTTGGAACATTCGGTGGCGGCTATCCGCTGCAACTTCGCCTAATGCCCCAGATGGAAAGCCTGATG
AGAATGCACAACAGCGAAGGTGCCGAGAATCTTCAAAGACTAAACGACAAGACTCATTCGCTGAATACACAGATTGCTTT
TGAGAATGCTCGAGCCTTTGAAAAAAAAGTCGAGCGTGAGAAGCAGGAGAGCCTTCGGAACCGGCCTCAGAACCTTGTTG
TCAATGGCAGTCGAGGGTGGGAGTCTTATTACCGCAATCAATTAGAGGGCAATGCGCTGGTGAGCGACTATGGCATGGCG
CCTGCTTTCACACCTGAAAACGCTTATTCCAACAGCAATATGGAGCAAGACTTGGAGGCTACCGAGTCGGAAGACGAAAA
AAGTGTCACGGGAGATGACCATCTGACGTCGGAGACTCCTGTTGCTTTGCGCAGATGCAATTCTTGTGAATTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62