GenePrediction:GLEAN_849 Details

Name: GLEAN_849
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:376384..377751 (+ strand)
Length: 1368
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:376384..377751 (+ strand)
Length: 1368
>GLEAN_849 class=GenePrediction position=GCSC_132:376384..377751 (+ strand)
ATGCACGATCCGTTTGAACATCCGGCTATAAAAGACTACATGCCGACCAAGCTGAAGGGCAAGACCTTTCGGATATGGGC
GGATGAACAGAAATGGGACCGTCGATTACGGACCAATCCCTTCGGGAAGAGCCGAAACAAGATTGAGCTTAAAAGTGCTG
AGGACGCTCAAGTGAAAGAAATCCGCCGAAAAGACCAGGAAGCCGGGCAAAGTGCCGCTCTTGCATCTACCTCTCTCATT
GCCACTAGTGGTACAATTTTCGATTTTGGGAAACAGGGCAATGATGTGGTAACGTTCCTTACAGTTATTAGCGGCTTGGT
GGGAGTATTGCTCTCATCAATGGAGAATTCTCTACCTGTCGCGGTTTCTATTATAATACACAACACCACCGATACCGATG
CAGGCCTGATAAACGTCGCAGTTGTAGGATACGGAAATAAGGTGCAGGCGCCCTTGGCAGTTCTCAGCTCTTTCAATCTC
CGAGCTACAATGCGTTACCCCGAAGACGGGCCAAGCCTTTGTTACGGAAAGATTCTCGGTGATTTTGTCAACGTGAAAAA
AGACTGCCGCAAATGGCTGACCCACTGCTGCCAAAATCATGGAAACTCCTGTGCAAAGCCGGATTGGTGTGCTAAGCTAC
CCCCGTCGTCGGGAAAGGACTTCAGACTGATCGATACTGCCGACGATCTCAGCATCAAGATTGTACAAGTCGACGATGTC
AAGACATCTTTACAAGGGTACACAATACCGGAGTATGCAGCCCTTTCGTACGTCTGGGGCGACGCAGGAGAGAACGCCAA
GAAACTTCATTTATCGAATGTCTCGCGTCTCAGTCAAGAAGGTCTTTCACCGGCCTTGGTAGCAAGGACAATATCAGACG
CCGTCAAGGTCACCAAGCAGCTGGGTATACGATACCTGTGGGTGGATAGTTTTTGTGTCATCCAAGAAGACCGTAATGGA
CCAGATGACCCAATAGCACGTCAATCACAGCTTGATCAGATGGGCAGCATCTACGGCCACGCAATTGTTGTCATTGTTGC
GGCCGGTGGAGAAGACGCTGAGGCAGGTCTGGCAGGTATAACAAGCTCCAGGAACACTAAGCAGATTGCGACGGAGGTCC
GGCCGAATATCAACATCTTGTTCCCCATCCAATACGACCGATCGTACGAAAAGTGGGACACTCGGGCGTGGACACTGCAG
GAAAAGCTTCTATCAAAAAGGATGCTTGTATTCGATAAGAATTCTGTCAGTTTCCATTGCAACGACGGCGTCTTGCGGGA
AGACATGCCAGCAAGTTATGCCGACAACGACCCCCCTCAGATGACCCCCGTCTTTCGGGACTCCCAGATTGTGGCATCAG
CCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62