GenePrediction:GLEAN_84 Details

Name: GLEAN_84
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:538451..545117 (+ strand)
Length: 6667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:538451..538564 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_179:539025..543151 (+ strand)
Length: 4127
Type: CDS
Source: GLEAN
Position: GCSC_179:543547..543733 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_179:543941..544009 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_179:544364..544500 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_179:545012..545117 (+ strand)
Length: 106
>GLEAN_84 class=GenePrediction position=GCSC_179:538451..545117 (+ strand)
ATGAACACCCCAGCCACAGACTACCGCAAGAAGGTCATGGGCGTCCTGTTGTCGTGCGTCGCGAGCTGGTCGCTGGCGTC
TTGCCAGCTGAGATCAGCGCCGTTGCTGGGCAACGTGTCAAGAAATAATGCACTGCATCCCAGCCCTGTTCCCCCATAAC
AAAACCCACTAACGCCTCTTTTACTTAGCATGCCAGCCAATTGCCAAGTCGTTTCGCCCCGACCTCTCTGCTATTGTTTC
TCGGGGCCGTCACCGACTCCCACCTCAAAATTCTGAGGCGGTATATCGACTTCGAACTGGAGCTCGACACTTTGCATCAT
TTCACGAGGTTACGACACGGCAAAAGCATATTCTCGGCATTTCGGGGGACATTATCGAGTTTCGAGCACCGCAGGGTCAC
ATACCGCCACCGCCATGACGGTGTTAGCACCTCCACCGCTCCCCAAGCGGTTTCCATGCTGGTGCAGAGCAGTCTACTCG
TGGGGAGGAGAGGTTTGTCCGCCCCATTCATTGTCTGCTTGGGCTCGCACACACGCTCTGGCGGGGTGTGAGAAGGCTAA
CCGTCGGGCCACAGTCGAAGCGCGATCTCGGGTTTATGGAGGGCGACCTGATCGAGTGTCTCAATGCGGGAGACGGCAGC
TGGTGGACCGGACGACTACGTCGAGACCGCCGGATGGTGGGTGCCTTTCCCTCGAACTTCGTCGAGCTGCTCCCAGACGA
CTTCCGGCCGGTGACACGATCGGTCAGCCCGCTTCCGGCTAGCAGCACGTCGGGCCCGAAGAGCGCGCCGCAAAAGTCGA
GGACGTTCCGGAAACCGTTCGAGGCCTACGCCAAAGCTCCTCACTACACAACGGCAAAACAGCCAGAGACATATCGACCA
GGAACTGTACGCGCCAGAGAACCCCCAAACAGTGCTGCTGGTCCAGGCCGGGGCCGTGGACGGATAGACGGCACCGATCC
CAACCACAACCACAACCCGGCCCCGTCTCAGGCAACATACGGCCAGCGGGCACCATCACCTGCTCCTCCTCCTGCCGCGA
GCTACAGAGCTCCATCACCAGCTCCGCCTCCAGCTGCAAGCTATCGGGCACCTTCGCCCGCTCCACCCATGGCCAACTAC
AGATCTCCATCCCCTGCTCCACCCATGAGCTACAGAGCTGCCTCGCCTGCTCCGCCCATGGCGAGCTATCGGGCAGCCTC
CCCGGCTCCCCCTCCAGCTGCAGGCTACCGTGCCCCATCGCCTGCACCTTCATACGCAAACTACCCCATGAGAGCTCCTT
CGCCTGCTGCTCGGCCGCCGAGTGTCTACGGGATCCGTACCGCATCACCCGCCCCTCCCAGAGCAGCTGCCTATGGGTCT
AGAGCTCCGTCACCAGCTCCTCCTCCGGCAGCTAGCTACGACTACAGAGCGGCGTCTCCTGCGCCCCCTGGCCACTACCA
CTCGCACTCGCTGCCGCTGGAGCAGTCTTATTACGGCGCACCCTCCGATCAGCAGTACGACCAGCAGATGCAGCCCCATC
ATCGCCAGCTCTCGCCGGCACCACCCATACATGCGTCTTACCAGGAGCCACCAGAGAAGGTGTACCAGCCCTACCGTTCT
GGTGCCGACTTGGCCGATGCCCCTCCTCCTCCGCCTCCGCCACATCGACATGTCATGGGCCGCAACGGGTCGAATGGTTC
CTATGGTGAATCCGTCGGCGGGCTTGAAAGACATGGATCCAACATGTCCTATATGAGTCATCGGTCCGGTGGCTATCAGA
CACCGCGTGGGCCCTCTCCAGGTCCGCTCTCGCCTGGCGGCGAGTCTGGCTTTACCCCGTCGCCGTTGCGCGAGGCGATG
GATGGCGTAATGGAGCAGCTCGGAGTCCTTGGCATGTCCAGAGAGGAGGAGGAGTCCAGAGCAGCAGAAGCCGCGGCGTT
TGACCCGTGGTCTCCAGCGTCGTTCGACACGGTCCACCGGAGTTCCCGAAAGCAGCAACTGCAACAGCAGCAACAGCAAC
AGCGCGAGCGCGGAGACCAGATCAGACGTCCATTGTCTACCATGGGCATTCCTGTCGACGAGGGCTATGAGACCTACAGC
GGCAGTGCGCTTTCGTCACACGACGTGGCAGGCAGCGGTGGGTATCAGGATGACGATCAGCCACTGCCACAGCTGAGCAA
TTACGTGGAGCGCATGGAGTCGCGGCTGCGTAGCATGCACGAACAGAAGCAGTCGGTGACGCCCTTCGACGATGGTGAGT
CGGATGCGCCGCCGCCACCGTCAAAGGGCGGCATGTACGAGCGGCCAAAATCGTCCATGTCGATTCTCTCGACGGATCCG
AGGCTGCGGCATCAGCGGTCCGCATACGATGTCGGTCGTCAGATGCTCGGGCGCACGCTCACGACCAAGACCAACGCGAC
GAACACATCTGTAAGCACACGCAGCACAGCTACCAACAGCAGCTCGAACACGCAGAGCACAGATCGCAGTCTGATGAGCG
GGGTGTCGGCCGGGGAGATCAGCGCAACCAGCGCGGGAAGTCTGGCGCGGAAGAACCGAAGCCGGGCGCAGAGCGCACTG
AACATAGCCGACTGGGACAGCGACCGGCCTGCATCTCCGTTCACGGGGGTGACCTACCACAGCAGCCACGCGTCGGACTA
TCCACGATCGAGGTCACAGCTGGGAAAGCGCGGTGCTGACGACATGCCCGGACTTGGCGAGCTATCGGGGCTCGGCGGAC
TGACGCAGCCCAAGTCGGTGAAGAAGACTGGGTTTTTCAAGAAAATTGTCGAGTCCGCCAAGGCCGGCGTGGCTAGTAGT
CGCGGCAGTATCGCGATGACAGGCTTTGGCGGCAGTACTGGGGTCGTGGTGGGCGGCATCGCACATGGGCAGAACCACAG
CAGCACCGGGATTCCGGCGAGCGGGCTCGCACGCGACTCGGGACGCGAGATAGGTGGTGGTGGCGGCAATAGCAGCAGCA
GCAGCGCAGACTGGGTGCAGGTGCGGCGCGACGTCAACCGATCGAACTCGATGAGCCGCAACGAGCGAAACGAGATGCGA
GACCGCTGCCAAATGCTCGACTACCCGGCAATGGACCCGGTGGACGAGCTATACGGGACGATCCAGGGTGACGAGGGGGT
GGACGGTATGCCGGTACTGCAGCCGATCGACTATGGCGGACTCAACCTCGGACAGGTGGACAAGAACTCGCGGTTCATCA
GCAACCTACCACCGACGACGACAGCTATCACGGTGGCGACGATGTATGTGTGCCGGCCATACCGCAGCGACGTGCAGCGG
CTGCGGGCAATCTTCACGTGGGTGGCGGAAAAGATCTCGTGGGAGGAAGAGTACGAGGGGACCGGGGCGGTGGACACGCG
GCGGGTGCTGCAAACGAAGCGAGGGTGCGCGCGGGAGTACGCGGTGCTCGTGATGGAGATGTGCATGGCAGCCGGACTGC
TGTGCGAGGTGGTCCGGGGCTACCTCAAGGCGCCGGGCGACCTGCCGGAGTTGGGAATCATGCCACGATCGAACCACTGG
TGGAACACGGTGGTGGTGGACGGGGAGTGGCGAATAATGGACTGCTGCGTGGCGAGCCCGTCGTTTCCACGACGGGGACA
ATATTCGAGCGGCACCAGCAGCGGAACGACAGCAGATGGGTGGTGGTTCCTGTCGCGGCCGAGCGAGGCGTGCTACACGC
ACATCCCTGAACATCACGAGCAGCAGCACTTGTGTCCAGCAGTGGCGCACGAGGTGCTGCTAAATCTGCCGTGTGCAGGA
CCGCCGTACTTCCGGAATGGACTGCGGCTGGCGGATTTCAACACGGCGCTGGTGCGGATCGAAGACCTGGAGATGGTACA
GCTGCGGGTGGAAGTGCCAGAGGAAGTGGAGTTGGCAGCGGAGGTAGAGGTGCGGTCGCTGGCGCGGGACGCCGACGGCG
ATTTCTTTGAGAGCGGCGAGGTGGTGCGCAAGCGGGCACTGGCGCAGGCGGACTGGGTGGGCGGTTCGAAGCGGTACACG
ATCAAGGCGTTGCTGCCGGGCGAAGAGGGCACGGGGGTGCTGCGAGTGTATGCAGGACGGCGAGGGCTGATGCACAGCGT
CAAGGACATTCCACACCCGCTGGCGTTCGCGTTGCCGGTGGTGCATACGGGCGACAACCCGGCCTACGACTTTGTGATGC
GGCATCCGACACCACATGCGCAGCGACACGACATTTACGTGGTGCAGCCGCAGTGCCAACGGCTGGCGCTGAACAACACG
TTTGTGTTTGCGATCCGGCAGCATCCGAGCTCGCTGGGAGCGACGACGACACCGACGCCGGGAAGCACAAGTGGACGGAT
GGGGGCGGCGTCGCCGGTGCCGTTTGCGCGGCCAAATTCGGCGATGAGCATCCTCTCGAGCGTGGCGGGTGGCGGTGGGA
CGGCGGGCAGCGTGGCGAGCAGCAGCAGCAGCGCGACAGGGCCGGCGATTGTGGGCAAGAAACCGGCAAAGCTGGCGATC
CAGACGCCGGGCGGCAAGATTCTGCGGCTGATGCGCAAGGAAGACCGGCGGGGTGGCGGTGGCGGGATGGGACTGGGGAT
GGGGATAGGCATCGGTGGGCGGGCAGCGATGGTCAGCAGTGACGACGAGGCCAGCGATGGCGGCACGTGGGAGACGATCA
TTAAGTGCAGCGAGCGGGGAGTGTGGCGGGGACTGGTGTTGGCAGACCGGACGGCACGATGGTGTGTGTTTGCGGAATGG
GTGTGCCAGTAGGGGAGGTGAGGGGAGGTGAGGGGAGGTGAGAGGAGGTGAGGGGAGGTGAGAGGAGGGGAGGGGAGGGG
AGGGGGAGGGGAGGTGAAAGGGGAAGTGAGAGGGAAAGTGAGAGGGAAAGTGAGAGGGAGGAGGTGAGAGGGGAAGAGAA
GAGACGGGAAAAGAGACAGGAAAAGAGAGGGGGAAAGATGAGGAGAAAGAGGTGAGGAGAAAGAGGCGAGGAGAGAAGAG
AAGAGGGAAGAGGTGAGGTGAGAAGAGGACAAAGTTGAGGAGGATGTGAAGGATAAGTGAAGGGAGCGAGGATATTATTC
AACTGAGATGAGGAGACGACAAAGACGAGAACACCTCACGAACAAACGACACGGAGTTGGGCGTCCCACATGGCCAAACC
AAAGGGGCCAACGGTCGGAAAAGGGGACCAGGGTCGGAAAACTGGACCTGGACGATCGAGACAGGTCAGCATTGGCATTC
TGGCGTTTTGTTTTTGGGCGTGGGCATTTGGACTATCTGGCGCATCGGGACTTGAGCTTGAGCGGGATTGGACCGGATAT
GATGTACGATACGTTTACGTTTTGCTATCTGCGCTGCAATGTGAGAGGAGTTTGATGTTCCGGGCGAAAACATGCGTTGA
TTCGGGGGCAGTGTTGGGGTGCAAGGTTGGTGCAAGGTTGGTGGTGCAGGGTTGGAGATCCAGGATGCGGAATTCAGGAT
CGAGCGATTAAGGTTCTTGGGCGAACGACGGACAGTCGACGGGACACTAGTCGGCCTTCATTGCAGAGGGCTTCGGCCTT
GCTGCGCCAGGCAGTCGTGCCATCGTCCGAGCTTCGTCCGTAAGTGCGCACGTGCTTACAGCGTGGCGTGGTAGAGGCAT
TTTGCGTGTTGTTGAGCGGGAGGTTGAGCATGTGGCATGAATGTTGTCGTGCGACTAGGCGACAGAAAGGTAGACAGAGA
GGCCTATAGCTAGCTCAACCCATCCGATCGAGGACCTGGGACTCGACCGGCAGCGGATATCGGCAGCCGGAGCGGGCGAG
ACGGGCTTCTAGCCAGGAAAGGTGGCCAGGAATGGTGGCTGTAGAGGATGAGGAGGTCAGGATGGAAGAAACGGAAAATG
CCCAGCACATGGATGTCAAGCCAGCACGTGAACATCCGGGCTAGTCCATCCACACCATCACCACGTCGTCCAGGCCATGT
GCGAAGAGCGGGTGGTGGAGGGAGGGGGAGGGGAGGAGGGGGTTGAGGAGATGGTGTGGATGTCGGAAGAGGGAGAGTTG
CGTGTGAACAGGTGTGGAAGGAAGGGCAGCAGAAAAGAGGGCGAGTGCGTGTTAGTGTTGTTTCGGGCGCTTCTGCTGGT
CATATCCTCCGGAACTGGAGACGGAACCGCAGCCATACACATAGTCCAGGCTCTTGCTATCGTCTCGCACAACACAACAC
AGCTTACCGGATGCAGCGGCCGCACCGAGGCAGACCAGACGGCGCGCTTGTCGGCTGTCTGCCGGCCGCCATGGCGACAA
GGAAGCAGGCTGCTGGCTTCACATCAAGGAGATGGTGGGAGCATCTAGGAAAACACTTGCATCACCATTACGAATGCAGC
CGGCGGCGTTAGTCGGCCGCCGCTAGTCCGATTGGGAAAGAGCCCGTCTCCGCCAGCCAATGGGAGTGTGGGCAACTTAC
AAGAGGCTGCGGCCGGCTGTCTCGTGTCTCGACAGATGTGTCGCCGGGGTCCAGGCGTCGTAATGGTAAGCAAGGCTCGA
TCGCCGTCGGGCGTATATGGGCTGGCTGCTGCGGTCCGGTCGAGCAAGACGTCAACAGGCTTGCCAGCATAGTCGACACA
GAATGGCAGAGCTGAGCGATACGCTATCGATCGTGGAGACAGCAAAGACGACCGCGCTCGAGGACCTTTTGACGTCCAAC
CTGCCGTCTGAGGAGGGGCTCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62