GenePrediction:GLEAN_851 Details

Name: GLEAN_851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:388984..390678 (+ strand)
Length: 1695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:388984..390678 (+ strand)
Length: 1695
>GLEAN_851 class=GenePrediction position=GCSC_132:388984..390678 (+ strand)
ATGGCCGGCGGAGTCAAGAAGCCGGTCAACGTGTTCCGGCTCAAGAACCTGGGCGAGCCCAAGGGCGTGTTCAACTGGCG
TCTGTGGTTCTCAGTCTTCTCGTTCGGGCTGCTGGGCGCAGCCCGTGGCGTGGACGAGGGCCTGATCTCGGGCGCATTCA
ACAGCAAGGACTTCCAGCACACCATCCACTACAGCACGTACTCCAAGGTGGAGCAGGCCAACATCAAAGCCAACGTGAGC
GCCATGGTGCAGATCGGATCGGTGGGCGGGGCACTGTTTGCATTTGTGGTCTGCGACCGGATCGGGCGCATCTGGGCGAC
GCGACAGCTGTGCGTTCTCTGGATCGTCGGCATTGCCATCTTCCTGGGCGCCAATGGCAACCTGGGGGCTGTGTATGCCG
GTCGCTTCATCGCTGGCCTCGGTGTGGGCCAGACGCCCGTCGTGGGCCCCGTGTACATTGCCGAGATTGCTCCAGCGTCG
GTGCGTGGATTGTGCACCTGCATCTTCACCGGCTTCGTCTACCTGGGCATCGTGCTCGCCTATTTCACCAACTACGGCTG
TCAGGTCAACCTTGGCGACACGTCGCATCGCCGCTGGATGGTGCCGACATCATTGCACATTCTCTTTGCCGGCATCATCT
TCTGCCTCACCTTTTTGCAGTACGAGTCGCCGCGCTTTCTGGTCAAGAATGGTCAGCCGGAGCGGGCCCTCGAGGTCATG
TCGCGACTGCGCCAGCTGCCGCCTGACCACGAGTATGTCACACGCGAGCTTGCCGCCATCCACACACAGCATCAGGAAGA
ACTTGAAGCCACGCGCGGTGCCGGCATGCTGGGCGTGCTCAAAGAGATGTTTCTCGTGCCTAGCAACCTCTATCGGATCT
ACCTCACCTGCATGGCCCAGCTGATGAGCCAGTGGAGTGGCGCTGGCTCTATCACCATCTACGCGCCCGACTTGTTCAAG
CTGCTCGGCGTCACCGGCACCAACGAGGGCCTCCTGGTGACAGCCGTCTTTGGCATCGTTAAGCTTTGTGCGGCTGTCAT
CTGCGCCCTCTTCCTTGTCGACGTCATCGGCCGCAAGCGCGCCCTCCTCACTGGCATCACACTACAGGCCATCGCTATGC
TCTACATTGCCGGCATGTTGACGGCCGTTCCCCAGCTCGGCATCGTCAACGACTACGAGCTCACTCGCACCGAGTTGGGG
CCTTCGCGTGGCGCCATCTTCATGATCTACCTCTCCGGCTTCGGCTGGGCTCTCGGCTGGAACAGCATGCAGTATTTGCT
CACGGCCGAGCTGTTCCCATTGCGCATCCGTGCCGTCAGCACCTCTCTCTCTATGGTCCTGCACTTTGCCAATCAGTACG
GCAACGCCCGTGCCGTTCCCAACATGTTGCTGCCCGTAAGCGATGGCGGTATCGATCCAAAGGGCACTTTCTGGTGCTTT
GCCGCCATCACTCTTCTGGGTGCCGCCTGGGTCTGGTTCTTCATCCCCGAGACCGCCGGCCGCTCGCTCGAGAGCATGGA
CCGTCTCTTCTCGCTTCCCTGGTACAAGATCGGCCGCTACGGCAATCGCGATGCCGACCGCCAGGACGTCGTCTGCGAGA
CTAAGCTGGACGAGGCTGTCGCAGCTGAGGTGGCCCACGTCGAGCAGAGCAGGCCGGAAGAGACACAGACCCGGCACACG
GAACTGCGTCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62