GenePrediction:GLEAN_852 Details

Name: GLEAN_852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:395227..396804 (+ strand)
Length: 1578
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:395227..395358 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_132:395428..395708 (+ strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_132:395768..396114 (+ strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_132:396185..396804 (+ strand)
Length: 620
>GLEAN_852 class=GenePrediction position=GCSC_132:395227..396804 (+ strand)
ATGGTTTTTCCAAGGGTTGCGAGGATCTATCGATCTTGTCTGTTCCAGATCATAGTTGTGGGTCTCGTCGCCTTTTGCGA
ACCTGGCATCTGGACGGCCCTCAACAACCTGGGCGCAGGAGGCAATGCCAGTGTAAGTTTTTTTTCATTTATGAAGATGC
CATTACCAAGCTGCCGGCTGACATGCATCACCACTGCACAGCCGCGACTAAACAATGCGGCAAGTGCCCTCACATACGGC
CTCATGTCGGTAGGCTGTTTCCTTGCCGGAGGCGTTGCCAACAAGATCACGTCCAAATGGACCCTTGTCATAGGTGCAGC
CTTTTACACGCCCTATGCTGCCGGCTTGTATTGCAACAACCGGTACGGAAACGAGTGGTTCCTTCTGCTGGCTGCCGCTC
TCTGCGGCATAGGTGCATCTCTGCTCTGGGCGAGCGAGGCCGCTATCGCGGTGGGATACCCAGAGGACGAGAAGCGAGGA
CTGTGAGTAGCCTCTTGAACTATGCTTTCTGATACAGCTGACTGAACTATGTCTTTATCAGGTACGTTGGCATTTGGATG
GGCATCCGGCAGTTGGGACCACTTGTCGGCGGTTCCATCTCCCTTGCTCTCAACGTCAACACAGCACACGCAGGCAAGGT
TTCGTATAAAACTTACCAGGGCCTTGTGGCCATCTCGGCCTTGGGGGCACCATTTGCGCTGCTCCTGTCGCAACCCCAGG
ATGTCATCCGGTCAGATGGTACCAGGATCCCTTACATGAAGACGACCAGTTTTTCCATTGAGGCTCGTGCCATCTGGAAA
CAGCTACATAACAAGTACATGTTGCTCCTCATTCCTGTCTTTCTTGCTGGGCAGTTCGGCACCACATACCAATCCAACTA
CTTGACGAGTAAGAGCCATCTTTCCCAGTGCGGCATGTGTGTGGTCGGTAGGGACGTCTCGCTGACTTGAGATCACAGCA
TATTTCACTGTACGCGCTCGAGCCCTGGCATCGTTCCTGACAGCAGTGGTTGGCCTTACAGCCAACATCTCGACTGGACT
GTTTCTGGACTGGAAGCGTATGTCTAGGAAATCTCGGTCTCGCATTGCATACATTGTTGTGCTCCTTTTTGTCACGGCCT
CGTGGGCCTGGAATGCGGCGATGCAAGTAGAGATCTTCGCTCTGCCAGAGACGCCCACTCTGGACTTTGGTCACGGCCGG
CTGTTCAACTCGTCCTTTGCCGTCTACATTTTCTTCCGATTCTTCTACGAAGCACTGCAGACGTACATCTACTGGCTCAT
GGCCGAGATCAAAGGTGCACAGGGCGATGGTGATATTGCGAGAACGACGGGCATCTTGCGATCGTGGGAATCGATCGGCA
GCACGATTGCTTACGCAGTCGGCACCACCCACTGGGGCAACACCAACCAGATGATCTTGGGCTTTGCGCTCTGGGGAGCC
ACCATCCCGTTCACGCTGCTCGCCGTCTTTGGCGACTGGAACGTGCCGGCTGCGCTGGCCGAAGAGGCCGAGAGCAGTGG
CAGCGAGCAGACACTCGAGACGCAAACTGTTGTTCTGGACCCTGAAGGAAAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62