GenePrediction:GLEAN_853 Details

Name: GLEAN_853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:401544..403089 (+ strand)
Length: 1546
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:401544..401761 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_132:401819..401927 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_132:401986..402126 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_132:402187..402532 (+ strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_132:402589..402691 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_132:402748..402837 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_132:402897..403089 (+ strand)
Length: 193
>GLEAN_853 class=GenePrediction position=GCSC_132:401544..403089 (+ strand)
ATGAAGCTTGCATCCACCTTTGTTGCGGCTGCCGTATGGGCCTCCGTGTCTGTGGCCGCACCGTCGGTTTCACCGCTGAG
CACCCGCGATCTAGCCGCAGACGAGGTCACCGTTCTGTCTCTGATTTCCAACATCACGGCACAGTTCTCCCGTCAGGTTG
CGGCCAAGAAACCTGGCTGTGGCTGCACGGCCGACAAGGTCGCCTACCGCCGTGAATAGTACGTGTCTTGTCTGCTCAAT
CGAAAACTGGCCTACCGTTGCTGACATCATCACAGTGGCAAGTTCACTAGGCAAGAAAAACTCGACTACATCAGCGCCGT
CAAGTGTCTCCAAGGGCTGCCGCCGCGGACGCCAGCCAACGTCTCTGCGGGTGCCAAATCTCGTGTGAGCTGTCTTACCA
TTTTGCACGACTTGTGAGCTAGCTAACTCAGTATCAAAACAGTTTGACGACTTTGTTGCCGTTCATATCCAGCAGACTCT
GACTATCCACTACACGGGCAACTTCATGCCCTGGCACCGGTGGTTTGTGCACACGTATGAAACTGCACTACGCGACGAGT
GCGGCTACACTGGATACCAGCCTGTAAGCACAGCTTGCCCCTTTCCACTTGTTTCTTTTGAAGCACCCATCTGATCAGGT
AAGTACTGGGACTGGCCTCTCTATGCTTCGGCACCCGAGGACTCTCCCATCTTCGACGGTAGCGACACCAGCATTGGTGG
CAACGGAGACTACATTGTGCATGATGGCCCCGTTATCACGCCTCCTTCTGGTGTTAGCGGCGGTGACATTCAGCTTCCTG
CTGGTACTGGCGGCAGCTATGTGACCACTGGTGCTTTTGCAAACATGACCGTGAACCTCGGCCCTGTTGGTGGTCTCCTT
GGTGTGGCTTCTGGTCCGGATGGCGGACTTGGCTACAACCCTCGCAGGCTCAAGCGTGACCTTGGTGGTGCTATGAACAC
CAGATACGCCAACTACACCACCGTGCTCAGTGAGTTTTATAAATCATGCGCAGATTACACATTTTACGCTTACTAACTAT
AATAGACCTTCTTACCTCTCCTGACATCTCGGCGTATCGTCATATTTCTGAGGGCATCCCTTACACCGTTGAGATTGGTC
CTCACGGCGGCATCCACTACACCATCGGGTACGTATGCCAGAAGAGAATCTCTGCTTTTTCGCTGACTAATAAATACATG
GTAGTGGCGACCCAGGTGGTGATCTCTTCACGTCCCCTGGTGACCCTGCCTTCTGGTTCCACCACAGTATGATGGACCGT
GTGTGGTCGCTCTGGTAAGTTAGCGAGCACAGCTCTTATCACGATAGCATCAGTCTGACCTTAAACCGCATAGGCAAACG
ATCGACCCCGCTCACAAGTCCGACCTCAACGCGACCAACTATGGACACATTACATGGGCCAATGACCCTGAGTCTCGCTA
TACTAGCCTTGACGATGTCATTGATCTGGGATACGCTGGGCCGAACATCACGATCCGGGAGGTTATGGATACAACTGCAG
GTCCTTTATGCTATTTCTACGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62