GenePrediction:GLEAN_855 Details

Name: GLEAN_855
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:413819..414977 (+ strand)
Length: 1159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:413819..414646 (+ strand)
Length: 828
Type: CDS
Source: GLEAN
Position: GCSC_132:414699..414977 (+ strand)
Length: 279
>GLEAN_855 class=GenePrediction position=GCSC_132:413819..414977 (+ strand)
ATGGAAGGCGGACGCAGCCGGCCAGACTATGACGGCGGAGCATCGCTGGACGGCTCGGAAACAAGCAGTGGTTCTTTGAT
AGCTAGCCAGAATCAATTTCCAGTGGAGCATTTCCTGGACGCCGGTGTCTTTGAGCGAGGAGGACTGGAAATTCCCAGAC
CTGAGGTTGCCGTGCCGCCTCAAGTCCAGGCTTGCCTGGGCGATATTGACAGAATGCGTCGCATTGCCCGGCAGTATTTC
GACACTGTCCATACGTGGATGCCGATCGTTTGTAGACAGCGATTCTCCATGTCTCTGATCAACCAACTGGCTTGTCCGCG
GGCAGATGTTGTTCTGCTGGTACTCTGCATGAAAATCTCCATCTGGGCTCCCCAGCCGGACCAATGCCACGCAAGGAGCT
CGGTGGCCTACGTGTCGGCAAAAAAGTTTCTTTTGGATTTGGAAATCTCGGGCATGCTGACCCTCGAGACGCTGCAGGCC
GGCGTGCTCATCTGCCTCTTCGAGCTGGGACACGCCATCTATCCGTCAGCCTACCTGACTGTCGGCACATTAGCCAGGTA
CGGGTCGGCTCTTGGCCTGGATAAGGATGCGCTGAAGCCGTTCAGCTCTGCTGCCGGCTGGACCAGAGCCGAGGAGGTGA
AGAGGGTCTGGTGGGCTGTCTTGATCCTAGACCGGTTCGTCTGTATGGCAACCCCTGGAAATGGATATGTTTTGCTGATG
GGTCATGGCAGCTATTTGGCACTGGGAAGTCCAGACCGATCGTTGGCCACACATAGTATCCGTCTATCAGACAGTCTTCC
GGTCGACGACGAGGCCTGGGATCGAGCAGTGAGTCGGCAGCTTGACTTGTAGAGATGGCCATGCGCTGACACCACCGCAG
TCACCAGTCCCGCCTCCGGTCCTGCCTCTTTCTTGCTCTACGCTCAACACGGGGAGATTCTCACGCATTGCTCAGGCAAC
CTATCTTCTTGACTTAGTACTGAGGTATCGATCCAATAATGATACCGATGCAAGGACGCGAGGCGCGGAAGCTGCACAAC
TGCGACGCACTCTTCTTTCCCTGATTGTCCTGGCCGATGTGGAGGGCAGTCTCCGGCAGTTGGAGTTTTGCCCGACAAAT
GCAGTCTGCTACAGGTACGATGAGAGCACCAGTGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62