GenePrediction:GLEAN_856 Details

Name: GLEAN_856
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:418173..418871 (+ strand)
Length: 699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:418173..418207 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_132:418264..418704 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_132:418763..418871 (+ strand)
Length: 109
>GLEAN_856 class=GenePrediction position=GCSC_132:418173..418871 (+ strand)
ATGACGAATGGCTCAAGATCTCACATATTCAGCCTGTGAGTCGTTTCCAACTCCGTTTTGAGACCCGACTTTCTAAAGCA
GAGACATCCAGGCTGAGTGACGAGGTGCTTGTGCACTTTTTATACGCTCGAGGCGTGTCCGTGCCAAGCGATGCAAGTCA
CGACGTATTGGTCGCGCTAGCCGACGAAAATGCTGACCTCCCTATTGTACCGGCACCGTTGACCCCGGCGACTGTATTTG
GCGTCCTCACGCTGGCTCACTTGAACTTCTTTCTGCGGAAGAAGCACGGCGAAGCCGTCAATGCAAATGCGGCATGGACG
ATTGCTGCGCCTCCGAAGCTAGCGAGGATCAAGATCGAAGCCTTACGGCAGTATGCGACACAGGAGATCTACCAGAAGCA
AATTGCCGGGCAAGACGAGGCGCTGAGCCAGTTCGGCCAGGACATTGCCGACACGTGGAAGCAAAAGATCGAGCTGCAGG
CCGGCGCAGAGCCCAGTCTCTTCGGACCACATCCGGCAGAGGATGATATTGAGTACGTTGCGCCGTTTTCTTAGCTGTAG
GAATGAATGTCATCGCTAACGATTGAACAGTGTGCTGTACGAAGATCTCGGACTGCTTAGGGACAGGACCAAGGATCGGC
AGCGGTCGCTGGAGAAATTAGGCATGGTGCTGGACTTGCTGCGGACAGGGAAAAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62