GenePrediction:GLEAN_857 Details

Name: GLEAN_857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:419469..421129 (+ strand)
Length: 1661
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:419469..419741 (+ strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_132:419791..420147 (+ strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_132:420218..421129 (+ strand)
Length: 912
>GLEAN_857 class=GenePrediction position=GCSC_132:419469..421129 (+ strand)
ATGACTGTTGCAAAGGAGCCAAAGGACGTACATTCGGCCCATCTGGAGCACGCGGATGGCGACGTGGTCCTCCCGGACGA
ACACGACGAAGGCCAATGGCACTGTATCAAGAACAATAAAGTCTGTGTCGCCTGGCTGTTGTACATCATATTTGTGCTCT
GCATCCAGGGCTTTGATAACCAGGCTGGCAGCATCGTCATTAGCATCGAGCAGTTCCGCAAAGACTTTGGGTATTATTAT
GACGGCAACTATGTTCTCCCGGCGAAGTGGCAGGTAAGTAGCCCTTGTTTTTGTCGTGTCAACCCTTGCTGACTGCTTTC
AGTCTGCCTTCAGCGGTGGACCTGTCGCCAGTGCAATCGTCGGAGCTCTCATCTCGGCCCAGCTGGCAGACCGAGTCGGA
CGTCGATGGACAATCCTGGCCACTATCTGCGTATCCTTTGTCGGCACAGGCCTAGAGTTTGCTTCGACGACAAATGCACT
CTTCTTCGCGGGCAAGTTTGTCAATGGTCTCGCTGTTGGTTCATTCAACACCATTTGTGTGTCCTACATCTCCGAGATTT
CGCCTCTGCCGATCCGTGGTCTCTTCACCGGCCTGTCCAATGTGTCGCTATGCATTGGCCCGTTTATCTGCACTGGCTTA
GGAGAGCGGTATGGCAACCTCAGCACCAGATGGGCATATGTGAGTTTATGTTCTATCTTGATCCATTCTCTTTCCTGTCG
CTCTTCTCTTCTCTCCGCTAAACTCACAGCGAGGAATCTTTGTCGCACAGTGGGGCTTCGGCTTTCTCGGTCTCATCTTT
TGTCCCTTTATGCCCGAGTCGCCCTGGTGGCTCCTCTCGGTCGGCCGGACAGCTGCAGCCCGACAGGCGCTCTCGCGGCT
CAGCGTCCCAGCCAACCAGCTCGACGGCCGACTCGAGCAGATTCGCATGACACAGCTGCGCGCCCAGGAGCAGACGGCCA
GTGCGAGCTACGTCGCGTGCTTCCGCGGGACAAATCTGCGCCGCACATTGCTGACAATCTGCCCGCTGACGGTGCAGGCG
ATGGGGGGTGTCATGTTCATCAGCAGCTACCAAACGTACTACTTTGAGCTCGCGGGCAACTCGGTGCACCGGTCGTTCCA
GCTCTCTCTCGGGTCGCAGGGCCTCTCGCTCGTCGGCAGCATCACGGCTAGCTTGCTGATCGACCGGATCGGCCGGCGAA
CAATTATCGTGTATGGAACGCTCGCCATGGCGGTGCTGCTGATACTCACCGGTGGCCTAGCAACCGCGACCGAACCCGGA
ACGCTTCAGGCCACTGTCGGCTTCATGATGCTCTACAATGCCGTGTTCAACTTCTGCCTCGGCTCGGCCGCCTACACGAT
CGTGTCGGAGATCCCGACGTTTGCCCTCCGGGCCAAGAGCATCGGCATCTCCATCGTCTGCCAGCAGGCCCTCTACACGG
CCCAGGCGTTTGTGTTGCCGTACATCTTCAACCCGGACAAGGCCAACCTGGGGGCCAAGACGTCGTTTATCTACGGTGGC
TGCTGCCTTATCAGTCTGGTGGTGTTGTTTTTCTTCCAGCCGGAGACGAAGAACCGGACGTTTGAGGAGCTGGATGAGCT
CTTTATGAACAGGGTGCCGGCCAGACAATTTGCGTCATATGTAACGACCGTGCAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62