GenePrediction:GLEAN_858 Details

Name: GLEAN_858
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:427646..429724 (+ strand)
Length: 2079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:427646..427760 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_132:427839..428587 (+ strand)
Length: 749
Type: CDS
Source: GLEAN
Position: GCSC_132:428662..429367 (+ strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_132:429531..429724 (+ strand)
Length: 194
>GLEAN_858 class=GenePrediction position=GCSC_132:427646..429724 (+ strand)
ATGTTTGATGACTCTAGCGACGATAGTGGCCCCGAGCGCCCCCCGAACTTTTGGGTTGAATCTCGATGTCGGCTATGCTG
CTTTCACTTTGAGAATGGCGACGAGATCATTGCCAGTGAGCAATACGGGATTTTCAATCAGCCTGTTGTAGCATGAGAAG
GACGGCAACTAACCCCGTTTTTGCGTGTGATAGACCTAGATGGCCAGAGATCGCCCTTTACTTATGCTTTTGTTCACGAC
CAGCAAACCGAGCTTGACCCTGTATTTTTCATGGACGTCAACGTTACATTCAGCCGCGACGGCACGAAACCTCCACACAG
AGTCAAACTTGCCGCCGGCTACCATGAGGAATGCCTTAACTATTGGGGATCGTCGTTCCCGCCTGCGGACTTCCCGGCTG
CCACTCGCTTCTCTTTTACAACCCCCGTATACAAGGAGCAGCAGCGTAAACTGCGGATTGAAAACTTACTGCTCCGCAAG
TTGCAGAGAGGTGAAATCCTGGTCGGATCGGCAGTCTTGCCTGTGGAAACGTCGGCGATGATCATGCGTATGCTCGTGCG
GTGGTTTGCTGCCAGCTCTACAAAGCAGCTCTGGGAGGACCGGACCAGCTGTGGCGCTGTGCTGGATTGCGCAAAGGGCG
TCTGGGCGCAGTACGTGCACGTCGATGGCGTACGTTACATTGCCAAGCTAACGAGCTCGCCCGAAGCTGATGGCATCCGG
CTATTGAATGGGGAGACGGCATCGGAGAAGACGGTACTCTACGTGGCGGAAGACCACCTGGGAGTGCGGCAGCTGGTGTT
TGCCGAGCCGGACCGTGACCTCTCGACGCTGCCAGGCGTAACAGGCCCGGTAGATGTAGCCAAGTCCAGCGACGGCAGAG
CTTCCATATGGTGGAGGACTTTGAATCTTGCTGTCGATAGCCGGCTCCATGCGGATTCAGACGTATGTCAGCCCCTCTTC
CGTGCATATACGGCTCGCAGAATACTATTTAGAGTCTAGGCTAACTGCTAGTGTAGGGGCTGAAGATCCGGACGATTCGA
GTTTGCAGTGTCCACGACAGGCTGCCAGGCCCCAATCGAACGCTGAAAGGCACGGTTTGGCCGACCCCTATGTCCCCGTC
CGAGCTTGCGGCACTGTTTTACCTCAAGTGCACCCCGTCGCTTTGCCGAGAAGGCGATCCTGGCGACCATTGCATGACAT
CCGTTGTATGCAATGACCCGGACGTGACGGGATATACTGGCTTCTGGGCGCATAATCTGGTGACTATCCATGCCCACCGG
CATGGCAAGGACACATCGTTCTATCAGGACTTCGACAGATTGGACCCAGTGTTTGGCGTGTGGCAATACTTTAGTATAGG
ACAAGACGAAACGATCACCGACTTGTTTCTTCAAAGGGGCCCCCGAAACGAGCACGTCAGCCTTCTGTTTCGTACGAGCC
TCGGCAAGAGTTTTGTGTTTGGACCTACTTGGAGACCAACCCTGTCGCCTCGAGCAGTAGAGTCAGAATACTACTTGTAC
GAGCACGTCTACCATCTCCCAATTAATATGCCGACCGAAATTTTCTTTGATGTGTCACCTGTGGGCATGCACAAGCTGGG
CCTTGCTCGAGGCGATGGGCAGCAAGCCGGATCTATCCCGCCTATCGGAGCAGTAGAAGCGCCGACATGTCCCGAGTTTG
GCGATTTATTTGTCTCTACCGTGGATCTAGATAGAGAATGTGGTGAGCATCACGACGTCAATCAAACCTGTTGATGCTGA
ACACACATGGCCCAAATCGATCCGTGGCTTTCTCTTGAACTATTCCGACAAATGTCGTACCCCCGAGACTTTTGGAGAAT
TCCGTTTCGATCATGTCGGGGAGACGATTGACCTGACCGGCGTAGACACGTTGTATCTCGGATTTCACAGCGGCAGCATA
TACGACCGCAACCCTCGGCACCTAATACGCATCTCGGTCGACCCTAAGACGATTGAGCCGACACTGACGTGGACGACTCT
GCCTCTGAAGGGCGTCGCAGAGCTGTGGTTCTGTCAATCGTTCTTCCACCTTACTCATGCCTTACTAGAGCGTACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62