GenePrediction:GLEAN_860 Details

Name: GLEAN_860
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:435695..437432 (+ strand)
Length: 1738
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:435695..436186 (+ strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_132:436269..437432 (+ strand)
Length: 1164
>GLEAN_860 class=GenePrediction position=GCSC_132:435695..437432 (+ strand)
ATGTCGTCTGGATACCAGGACAACAAAAAGTACCCGGGCCCGGGCCCTGTGGTGGGCGATGTCGAGGTTATCTCGGGCGA
GATCGTGCCTGTCGGGCTGAACGAATACGAGATGCAGTTCGCTGAGGTCGGCATGGTCAAGCAGGGCCTGAAGCAGCGAC
ACATCCAGATGATCGCATTGGCCGGCACGATTGGCACGGGTCTCTTTCTCGGCTCCGGTCGTGCCATTGCCCATGCCGGT
CCTCTCGGCGCCTTTCTGGGCTACTCCATCATCGGCGTGACGGCTGCCGGCGTCGTCATGTCTGTGGCCGAGATGGGCGC
TCTGATCCCGCTCAACGGAGGCATCGTTCGCTACACCGACACCTTTGTCGACCCGGCGCTCGCCTTTGCCAACGGCTGGA
ACCTGGTGTACTCAAATATTGTGTCGCTACCGGCCGAGATTGTCGCCGCCGCCGTGCTGGTCGAGTTTTGGGTCACCGTC
AACAACGCAGTCGTAAGTTCTCTCTTTCTGTCTCGTTCCATTTCTGTCCAGCTCCATCCGTCCAGATGCTAATCTGTCCA
AATTCGAATCGCAGTGGATCACCGTCTTCTCGTTCCTCACCATCGCTACCTCCCTCTTCTTCGTCCGGCTCTATGGCGAG
ATGGAGTTTGGCTTTGCCATGCTCAAGATCATCCTCATCGTCATGGTCAACGTCATGGCCATTGTCATCACTGCCGGCGG
TGCGCCGAACCACCAAGTCATCGGGTTCAAGTACTGGCACCACCCCGGTCCGTTTGTGCAGTACCTCGGCGTGTCCGGCT
CGCTCGGCCGCTTCCTCGGCTTTTGGACAACCTTTAGCAACGCGCTGTACTCGTACTCGGGCGTCGAGGGTATCACCTTG
GCAGCCGCCGAGGTCGAGGCCCCTCGTCGTGCTATTCCCCTGGCAGCTCGACGCATCTTCTGGCGTGTGGCCATCTTCTA
CATTGTCACCATCGGCATGGTCGGCCTTGTGGTCCCGTCCAATAGCAAGCAGCTGCTCCAGAGCACCGGCACCGCTGCCC
AGTCTCCTTTTGTCATCGCCGCCAAACTTGCCCACATCCGCGTGATGCCGCACGTCATCAACGCCATCGTCCTCACTAGC
GCCTGGTCTGCTGCCAACTCGGGCATGCTCAGTGGCAGCCGCACGCTCTATGGCCTCGCTCGCTCCGGCCGGGCCCCCAA
TATCTTTCTGCGGCTCAACCGCTTTGGTGTCCCTTATGTCGCCATCGGCTTCTTCGGCCTCTTCATGGCCCTCGGCTACA
TGACCCTCTCGGACTCGGCCTCGACCGTCTTCACCTGGCTGCAGGATCTCATCTCCATCTCCACCCTGACCAACTGGATC
ATCATCTGCATCACCTACCTTCGCTTCTACTACGGCTGTCGTGCCCAAGGCATCGACCGCAGCGAGCTTCCCTGGGCTGC
GCCTTTCATGCCGTGGCTGCCGTGGGGCAGTCTGGCCCTCTTCCTCTTGCTGCTTCTCACCAGTGGCTATACCACCTTTA
TGAGTCACCACTGGAACAGTGAGACCTTTGTCTCGTCGTACTTCAACATCCCCTTTATCTTTGTTGTCTATTTCGGGTAC
AAGTTCGTCAAAAAATCCAAGATCGTCCCGCTGAGCGAAATTCCTATCCGGCCCTACATCCAGATCGCCCTGGACAACCC
GGAGCCGCCAGAGAAGCCTAAATCCACGTTACAGAAGCTGAACATACTGTGGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62