GenePrediction:GLEAN_861 Details

Name: GLEAN_861
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:439150..447506 (+ strand)
Length: 8357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:439150..443492 (+ strand)
Length: 4343
Type: CDS
Source: GLEAN
Position: GCSC_132:443692..443782 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_132:444795..444932 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_132:445560..447269 (+ strand)
Length: 1710
Type: CDS
Source: GLEAN
Position: GCSC_132:447327..447506 (+ strand)
Length: 180
>GLEAN_861 class=GenePrediction position=GCSC_132:439150..447506 (+ strand)
ATGTTCGAGGTGCGCATCCACTGCATCGACTACTGTCTGGCGGCCCCAACAGAGGTGGATACGGCCGCTTCGCGCGCACC
GCTGCACCGCGCCTTTCGGAACAAGAACAAGGGAAATGGACGGGACCAGGAGAGGGAGTCGGACAGGGAAACAAACGCGG
ACAGCACCCGCAATTATGGCCCCAGGGTGCCGATCATCCGGGTGTTTGGAGCGACGCCGGCGGGCAAGACGGCCTGCGCC
CACATCCACGGCGCATTTCCCTACCTGTTTGTGCCTTTTGACGGATATTTCCAGCCGGCCGACGCCGACAAGGTGATGGA
TCAGCTGCGACGCGGCCTCGACCAGGCGCTGGGCCGCATCACCGTGCTGGCCGTGACGCTGGCCCGTGGCGTGCCCTTTT
ACGGCTTCCACGTCGGCCTGCGGCTATTCTGCAAGATCTATCTGCTGGACCCGGCCGCAATGTCGCGCGCGGCCGAGATG
TTGCGTCTGGGCCGCATTGGCGGACTGCCCGCGCTACAGCCCCATGAGGCCCACGTACCCTTTGTGCTGCAGTTTATGAC
TGACTACAACCTCTACGGCTGCGACGTGCTGCGGGCGTCGACGGCGACGGCCAGGCGGCCACGCACAGGAACAGACGCCG
TCGGCGGCGACCTGCTTCAGATCGACATTGCCGCCCACCACATCCGCAACCGCGACGCCGCGCCCGAGCGCCGGATCCAC
GAAAACATGCCCGAGCCGCCGACCAATCCTGACGAGCGACTGGTCTATAGCATGGCGTCACTGTGGCGCGAGATGGCCGG
GCGGTATGGCCGGGCCGACCGCAAGACCAGCGCAGAGATGCGGCAGTCGTTCGAGGCCAACACACAACAGGCGTTTGCTC
AGCTGGCCGCATCAGCATCGGACCCGCGACGCACACCGTCCGCCTGGCCCCAGGAGGCGGCGTACCGGCGACAGCTGGAT
GATATCATCGCGGCGGAGAGGCGCAGAAGCAAGGCAGCCGCATCTGATACGATACTAGAGCATCCACTTGGAGACTGGGT
GCCGACAACGCGGCAGTCCGTTGAGGATTTCTACCCGACACCAGACCGGACGGAGAACAAGAAGCGGAAACGCAGGCCGA
GTGAGGAACTGCTATGTGGGAAGACAGACACGAAGACCGGAGGAGTTGGCTTCTCACCGTCACCAGACTTTGAGATGAAG
CTGAGGGCACTGCTGCACGAGCAAGAATCGGGCGGGAGTGGTAGAGTGGCGGTCGTGGATAGGAGCAGCGGTGCTCCAAA
GAGATCAGTTCTGCCAATCCGCAAAAAAAGCGAAAACAAACCTGCTGCAGAGCAGACGCAGCGCCCTCTGACACAGATGT
TTACGGTTACCAAATCGTCCTTTCCACGAGACCACAGCAAGACGACGCCAGTAGTTCCATCGACAGACGAGAAGGTTAAT
GATGTTGTAATTCCGTCAACACCCGACTACGATTTGCCTCGACTGTCAACACCTTCCCGACGCGAGCCCACATGGTCTCC
AGAAGCCACACACAATCCCAATCAACCATTTTACAGCGTGGGTGACGGTGTGCTGGCTTTTGCTAGACGGCCCCCGTCCG
CCGACGATGTGACGGCTACACTACATCGACACGGCTCCGAAGAGCTGCACCAGGACGCCTTCTTCAGTGACGAGAAAGAC
ATTGTACAGAACAAGTACGACAATACGGGTGCGGGCAGACGTTTGCCGGTGCGACTGCCTGCGTTTGCGCCGTCACCAGG
CTCCAAGGACACGAGCGCCTCGTTGCTGTCCGCCTGCAACGCCCGTTGCTGGGAGCTGGCTGCCCTGCCGCCTTCGGTCG
GCGCGGTGGAGACATGGCTGGCGGACGAGGATGCGCAGGTTGCCAAGAGAGAGAGGACAGCTGCGGAAGAGACTGCAGCC
GCTCGACAGCGCATGACTACGGCACAGCTGCCACGATCCGAGCGGAAGACGTTGAGGCCGTTGCCCAAAGCAAGGTCACG
AGGGGGCGGTATGCGTGTGTTGGTGCTGGAGCTACACGCCAACTCGAGAGGGACGTTTTTGCCGAATCCAGAGCGCGATC
CGGTGCAGTGCGTGTTCTGGCGAGTGTCAGAGACAGACAGGGCTACCGACAGAGACGCAGAGAGCGGCGTGATTACGGTA
CAGCGGCTGCTGCGTTACGAGAAGCGCGTGGAGGTGGCGACAGACGAGCGTGACCTTCTGAAGCGCGTGGTCGAGCTGGC
GCGACGGCTGGACCCAGACATCCTGGCGGGGTACGAAACAACAGCGTCGTCGTGGGGATACCTGGCAGAGCGGGCAGCAC
TGTACACAGAGACGGAAGACGGCCTCTGGCAGGCACTCGGCCGGATACAGCAGCCGCGAGAGTCGGCCATGTTTGAACGT
GGAGACCAGTCCCACATGGTGACAGGACGTCACGTGCTGGGAATCGCAACAGCTGTGCGAACAGACGCAGACCTGCGACA
GTACACCATAGCCAGCGCGGCCTGGAAGCTGCTGCGACTGCGGGTGCCAACATATGGACCGCGGGTGCTGACGGGCTGGG
CTACCAGCGGACGGGCACGCGATCTCACGAGACTGGTGCGCTTTGGCTGTCACCGGGCGGCCGTGGGAGCGGCATTGCTG
CAAGTAACGGAGTTTGTGGCACGCACCAGCGAGCAAGCTCGCGTACTGGGCGTCGACTTCGCATCCGTCCTCGGCCGCGG
GTCGCAGTACAAGGTCGAGTCGGTCATGTTGCGGGTGGCCAAGCCCGAGTGTTTTGTGCTGCCGTCGCCCAGCCGCGAGC
AAGTCGGCCATCAGAAGGCGGCTGAGGTGGCGCCGCTGGTGCTGGAACCGCGAAGTGGCTTCTACAGCAGTCCAGTCATC
GTCCTCGACTTTGCCAGCCTGTATCCGAGCTTGATGATTGCGTACAACCTCTGCTACTCGACCTTTCTCGGCAGTTTGGA
CCCGCTGTATGACGAGAGACCGAGACAGAAGAGGGACGTGAAGCCGCACGAGACCGATCTGAACAGCAGTGGAAGCGCGG
AGAATGAGCCGGCAGAGGGCGCTGTCACCACTACCGTGGCTGACACCGACAACATCAAAGCCTCAACGTCCATAAAAATG
GGCTTCACCACGTACGAGCGACCAGACGGCCTGCTCGAGAGTGCCAACCGGCTCGGCGTGGTCGTGGCACCCACGGGAAT
GCTGTATGCAGGTGCTTCGACCAGGCAGTCGCTGCTGGCCAGGATGCTGGCGGAGCTGTTGCGCACGCGAGTGATGGTCA
GAGCAGCCATGGGCGAAAACGGGGACGGTGCTGATGCATCCGAGAAGCAGCGGCTGCACCATCGCCAGCTGGCGCTCAAG
CTGCTGGCCAACGTGACATATGGCTACACGTCGGCGTCGTTCTCGGGCCGCATGCCCTGTGTCGAGGTGGCCGACAGCAT
CGTGCAGGCCGGCCGCCAGACACTGGACCGTGCAATGGCCCTGATCCACGCCGACGCCCGCTGGCAGCCAGCCGAGGTGG
TGTATGGCGACACCGACAGTCTCTTTGTGCACCTGCCGGGCCGAACACGCGCCCAGGCGTTTTCGATCGGTGCCGCCATG
GCTGCCGCTGTCACGGCTGTCAATCCAGCGCCTGTGCGGCTCAAGTTCGAAAAGGTCTACCACCCCTGTGTGCTGCTGGC
CAAGAAGCGCTATGTCGGCTACCGCTTTGACTCGCCTCGTCAGTTGGCGCCCATCTGGGACGCCAAAGGCATCGAGACCG
TCCGTCGAGACGGCACACCGGCCGCTTCTGCTCTGATGGAGGCCAGCCTGCGCCTCCTGTTCGACACGGCCGACCTGAGC
CTGGTCCGTCGTCTGGTCCAACAGCGCTGTGCCGACGTCTTGGGTGGCCGTGTTTCCCCTGCTGATCTCTGTTTCGCTCG
CCAGGTTCGCTCGCCAGCCTCCTATCGGGCACCGCCGCCCGGTGCCGTCGTTGTTGCCCGCCACACTGCGCGCGACCCGC
GTGCTGCTTTGCTGCCCGACGGTGACCGCGTGCCCTTTGTCATTGTGGCCGGCCCACCAGGCACGCCGCTGCAGGACCGC
TGTGTCGCGCCCGCCGAGCTTGTTCGCAGCCGCCATCTGCGGCTCGACGCTGACTACTATGTCCGCCACAGCCTGCTGCC
CCCGCTGGACCGTGTGCTGCGTCTGGTCGGCGTCGACGTGGCCCAATGGTATGCAGACATGGCCCGACCGCCAAGAACGA
CGACTTCATGGTGGGTGGGGGACGACGATGAGGACGGCGGGGTGGGATCAGATGGCGGTCCCGACGGCCAGCAGACACTC
GACATTTGGCTGCGGCAATGGCGGTGTGCAAGGTGCAATCGGCCAGTGCGTCGTGGGGCAGTCAAGAGACAGGCAGGAGG
AGGGCGACCAATCCGACCGGCACCAAGCAGAGTGTCTGGCCCTATCGCTGGTCCAGTCGCTGCTTCTGTCGCTGATTCTG
TGTTCTCCCCTCCTCTCTGTCGTTCCTGTGGAGACGACCCCCACACGTTGGCAGTCCTGCAGATGCGAGCTCGAGATACC
GAGGCCGAATATCGCTCCGTCCTCGACGGGTGTCGTGGTTGTGCCGGTCTGGGCCCCCAGGATCCTGTGCGTTGTGAGAA
TATGATCTGTGCGGTTTTCTGGGAGCGCGCTGAACGTGCAGCCAAGGCACGAACTGAGCGGGCCAAGGCGCCATTAATGG
CCATATTGGCACGGCGGGGTATGGAAGATCTGGAGTGGTAGTGTGGGGGGAAGTGGGTTTTGGGGATTGTCGGCGAGGTT
GAGATCAGGATGAGGATTGGGCCTCATGATCGCCGACTGAGACGTTAAAGTCGCCGACCATGGTCGTAGTCGACATAACG
CGTGCATACATAGTACATAGTATATCGCAGTGGGGCTGCATTGCTAGGAGGCCGGTTTTATGCTTTCTTTTGTCGTTGGC
TGTTGATTGAAGGCCAGCGTTGGTTTGTCAAGGTTGGTATATTGGCTTAGGACGAGAAGGGGGCGTTGAAGCAGAGCCGA
GAGGATTGGCAGGGTCGAGTCAGTAGTGTCGACGTCGGAGCCTCGAACTTGGAGCAGCCGTTGGGCTGTCGGCCTGTTGT
CTAGGAGCTTTGCACTGCATAGGATAATGCATAGTGCATATTGTAGATTGCTTCTTGGTGTGCCGACGTGCAGCTCTGTT
TGCGCGATTTTTTAGACTGTATTAGGCGTCCGTTGGCAGCACTCATTCTTATTCTCTTCTACTTGCTTCTTCTGCTTCTT
CTTATCGTGGCGCTGTGGGACCTCCTTCCCTTTCTCGCCGTCTTCTTGCCTATCGCTCCTTCCCCTCTTTGTCTGAAAGA
GCGGTCAGCTGTCAACAGGGATAGAAGGAGTGAGAGCTAAGGGAAGAGAAAACAAAGGCAAAGAAAAACAACGAAATAAA
CATTCAAGGCAGAGAGAGGATTGCGAAAGCCCAGAACAGTGCTAGCCAGAGCTGCTGCGAGAAAGCAAGAAATCACACCA
GAGCAGTCGAATTCGGCCCGGAAGCCTCCTCCCCGGCGGGGCCTGCGCTTAAAGACATTCCTCCTGGACAGTCCACAATC
ATGCACATTGCTCGACCACTCGCACGCGTCTGACCGACAAGACAGGCCCAGAGCCCAGAGCCCAAAGCCCGCTTGCAGCA
CGACCACGTCGTCGTGCCGTCCGGCGCTCTGGCCATCCTGCGACGGCATGTCGGAGATACGTCGGTCGCTGCAGCGAGCA
CAGGCCTATCGGACGTGTTCCCTGTAGGTCTGCCGGCGTCGTCACATTGAGCCTTTCTGGTCACAGCCACTACCGCTTTC
CTTCCGCCTCGATCTTCGACTACTCGTGTGGGCAGCAGATACGCGGCGCTGCAACGCCGAGACACACGGCCTGTTTGATG
GCATGTTTGTGGGCACCGCTTCAAACGTCGTACATGCATCCAATCGGCGGATGGGCCCTATCAAACTGTCTCGACCGTTG
CGGACAGCCCAAGACACCTGCCCAACTGATATGGCTCGCGACTCTCACCTCCCCCAGCTGCGCAGATACTACTGTAATGG
GATTCAGCATGGAACATTGCCTCCGTCACCGTCTTTGTCGTTTTCTCAACGTCGCGACTTAAAACTCGTGTTGCCACCCG
TCTTTTTCTTGTCCATTTGTCTCGATATCGCGAAGCTCGCCTGCACGTCATTCACAAAGTTCTCCTAGCTTGACACACAA
GTTTGTTCTTTCTACCCACACTTTCCCCGTTGTTCGTAGCTAGAAGCCCCAGAGAAGCGATCGGATCCACTGGCAGACCC
GGAGAGATGCCGAGCACCCCCTCAATGGAAATTCTCAGTGGCCCGTCCGAAATGGGAGCGGATTCTGACGCGAACTCGGA
TGAACCGCAGCTGCAGGAGTTGCCACAGATGCCCAATGATCTGTCCTTGGGCGACGTGTCTAAAGATGAAACCAGCATCG
TTGTGGACACCGAACCGATAGAAACGGACGATGAAGAGCCTGTCGGGGAGGGGCCCTTCAGCGTGCAGTTTGAGGCTGCA
TGCGAAGAGGCCCGCCGCAGTGCAGTCGGAGACTTCACCGACTCAGACTCCGATGGCTTCTTCATAGTCGCAGAAGAGCG
TGGTCACGTTTTGGGCCAGGGGCCCTTTTCGGGCGAGGGGCTGAGTGAGGGGCCCTCTACAAGCCAGGGATCCTCTCCAG
ACCAAAGGCCTTTCGCAGATGAAGAACCATCTCCGCCTGGAACTCCCAGGAGCAGCGAAGACATCGGGGCCAGCGGAAAC
TTGTTTGGTGAACAGTACGGAGGTCCGATGGGTGTCGAAACGGATGAGTCCAGCAACATGCCGATGCCCATGGCCATGGC
CATGCCCACGTCCATGCCCACATCCATGCCCACGGCCGCAGAGAATTACGAAGAAGACAAGGAAAGTGAAAACGGCGAAA
ACGATGCAGTAGCAGTCTCGAATATGGAAGAGGACGAGGATGAGGACGATGGCAGCGAAGAATATTTCAGCCAATTTAAG
CCCCGCCCGGATGAAGATGACGGCGCGTACATTGACAGTACCAGCACAGGCCGCTATGATCTTGGACGCACTGACGCAGA
CGAAGGGTCCCTATTTTGCGCGCTCACGCCGCCTTCGACGCCTATCGACATGATCAGCCTGCTGAGTGCCGTCAACGTGC
TGCCGCTGCAGACGTCGCCACTGTTAGCCCTGCAAGAGAAGGTGGCCGCCTTCTTTCGCCAGGGCCCTGACTTTGCCAGC
TTTGCCTTTATCAAGCTACAAGAAAGTCTGGCCGAGCACCGCTACGTTTTGCAGGGCCCGTTTATCAAGGTGGAGCTGGC
GCGCCACAGCAGCGAGCTCTTCAGCACCTTGCACAACCTCGGTGGGCTGGACGCCGGCGTGCTGAGCGGCTATGACCATA
GTGGCAATGGCACTTTTGGCGGCGCCGGAACATTTGGCGGCTATGACGGCTACGGTGCGTATGACGGACTGAGCGCTCTG
GCTAGTCTCAACACCCCTAGGCACAGGCACAGCAGTTTGATCCGTCGCTTTGGTCCTCTGGGACGCCCCGACCTCCACAA
AGCAAAGCCGGTCCACAGCAGCAGCAATGCCAGTCTGCAGGGTGACCTGTGGCGTTCAGACCGTATGGCGTCGTCCCTAG
TGATGCTATCAGCAGCCTCACACTCCGACACCTGCGTGCACGGCACCTTGGGCAAGCACTCGCGCCTGCTGGGCAGCGCA
CCGCCGTTCCGCGTCACACAGAACACGAGGTCGGCCTCACTGCGAACTGCCATGTTCCGCGCCAAGCTTCTGGCCCAGCG
TGCCAATCGTACAACCGTCATGGCTGTCTCGCTCGTTGACGTGCGTTATGTTGAGATGGCCTGCTTCTTTGGCGACGCGT
CCTGGGAGGACGATCGGTACCTGAGCTTCGGCCACATCGTCACCATTGGCGTCGGTCCCGAGGGCGTGATTATCTGGCAG
GCTTGGGGCCCTCGGGGCTACCGGCTTGACGACTATATACGCGCTGGCCATGCGCGCCTGCGCAGCTGGGAAGAGGCCGA
GACGTTCGCCAAGGACTTTGATGAACTAGCTAGCTCTTCGGTGAGTTTTTCAGAAGATAGCGTGATTGCAAACACAACCT
TACTGACACGACTTCAGGGCATTTGGAATGCCCGCCGCAACCACCTCTACCAGCAGCTGTTCTACATTGACATCAACCAG
ATGTGCAAGCCGTCCTGCCTGAACCGGCTGATCACGCCGCACTATGAGCCATGGGTGCGGATCCACACGTTGCATAATGT
CCTGTATGAGAACATGAACAAGTTTAGGTTTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62