GenePrediction:GLEAN_862 Details

Name: GLEAN_862
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:450193..451290 (+ strand)
Length: 1098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:450193..450304 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_132:450547..450716 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_132:450794..450968 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_132:451157..451290 (+ strand)
Length: 134
>GLEAN_862 class=GenePrediction position=GCSC_132:450193..451290 (+ strand)
ATGCTTCATGATCGGCAGCAGCACGTCGACAAGGTGCCAGACCCGCGAAATGTCGTGCTAGACATGCAGACGGCGGAAGA
AGAAATGCGACCGGCGACGGCCCGTCTGTACGGTATGTGCAACGCTCCAGATCGGCTGCCACAACGGCGACACCCGACCG
GATTGGATGGATAACGGCGGCAGGCAGGCCGACATGGCGCAGCAGATACGGGCACAGATCAAGCAAGGTGAAGAGACCCG
CCGTGGAGGGGGGATACGTGTGCAGGTTTTGGCGCTCTAGAGCAGCTACGTCTCTGGTGTTGCCTGAGAAAAGTTTCGGG
CAGACGATGCGAGCACGCAGAGCTACAGCGACAGCTGAGAGAAACTGCCTCAAGGCTACTGTTGGTATTGACGAGGAGTC
TACGACCGTGTCAAGGATTACTGGAGCACATCCCAGCCGGCCGGAGCCGGCAGTCGAGGCTATTCTGGACGCGCTGACCC
TCGAGGACATGAAGATGGACTTTACCACCCTCTACCTCGATCACGTCTTCCCCTTTCTCTTTCCCGCCTACCGCCGCCTA
TGTTTGAGGGTGGCCGAAGCTGGCTGCTCGCCACACTCCAGCACAGCCGCGCCCTCTTCCACACCGCCATGAGCCTGTCC
ACCTACTTCCTCGCCCACAACGTCTGGGATGTCCTGGCCGGCCGCATGGACGCCGCTGTGCATGCAGTCCAGGCCGACAT
CACCGCTCTGGCTGTTAGTGCGGCCACACCACCGGCAGACCCGGTTATCCGCGAAAGTATGATTAACGTGTTGGGTCTTC
TGCTGCAGGTGTCCACACCGGCACTGCTGCACAGTCTATCTATTGCACGTGACCCTGTGGGTCAGTGTGCAGAGTTTTCA
CTCCCGCAGTACAGCCTGCACTAGCTTCTAGTGCATGAGAATACATGCACCTTTCCACACTATCATGGCCACACTGTATT
GCAGGATGCATGGCTCTGGAGAGTCAGGAGCAAGCCTTCTGCGATCTCTTCGAAGCTGCGGGCTCCCTTCAGGCCTTTGG
AGGGCCGGGGATAACGCTGCGTATCATGCAGAATGTGCGGAAGATTCGTAAAACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62