GenePrediction:GLEAN_863 Details

Name: GLEAN_863
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:454062..456293 (+ strand)
Length: 2232
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:454062..454070 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_132:454271..455137 (+ strand)
Length: 867
Type: CDS
Source: GLEAN
Position: GCSC_132:455595..456293 (+ strand)
Length: 699
>GLEAN_863 class=GenePrediction position=GCSC_132:454062..456293 (+ strand)
ATGGGCAAGGTGCGTGCGAGGTAATTTATTTTCTGGCCTGGAATTTCAGGCACACACGGGTCAAGTACTCTGCAGCAACG
TTTAGTAGCGCAAATAACGCCCGATGTGAGTTGCAAACAGCCACCAGAAAACGTGTTGCTACCGACGAGGCACTTGATTC
CATGGCGAGCTATATTGAAGGCCTGCTACTTCCACATGGACGTCCTCAGCTAGGTACATCGGTGCTCCCAGCTCTGTTGG
ACTGCATTGCCGACATTGCCAAAGCGTTGCGCAAGTCCTCCCGAATTACCCTCGCCGGAACGTCCAACGTGTTTGGCGAT
GGCCAGCTGAACGTGGACATTGCTGCTGAGGATCTCGTCCGCACGGCCCTGGCTCGATGCCCTAGCGTCGTAACTGCGAG
CAGCGAGGAAGATCCGATAGAGAAGCCGACAGGCGTGGCTGTGGACGCAAATGCCTCTGAACAGTACACGGTAGCCTTCG
ACCCTCTTGACGGTAGTTCCATCATTGCGCCAAACTGGACCGTTGGCACGATTATCGGCATCTGGGACGGGGCCTCGGCG
CTGCGCCAGCGGCCGGCAGACAAGCAGATCGCCGCCATCCTGGGCGTCTATGGTCCACGTACGACGGCTATCGTGGCTCT
GCGCGTGCCGGGTGCCGAGCCGGTCTGCTTCGAGGTCGGCCTCGAGGATGGTATTTCTGGTGGCTACGAGACTGTCCGAG
AATGTGTGCGCTACGCCGACGCTCCATTCAAGACGCGCTACTTTGCACCGGCCAACCTCCGGGCGGCCGCGGACAACGAC
GCGTATCAGCGGCTGATTACGCAGTACATCCAGAACAGATACACGCTGCGATACAGCGGCGGCCTCGTTCCGGACATCGT
GCACGCGCTGGTCAAGGGCCACGGCGTCTACATATCGCCGGTGACGGCCACCAGCGCGGCCAAGCTGCGAAGGCTGTACG
AGCTGTGTCCTGTGGCGCTTGTGGTGGAGTGCGCTGGAGGACGGGCACTTGACCCACTGGATGGCGAGCCCATTCTTAGC
CGGCCGTCGGTGAGCTGTGATGAAAGGGCGGGTTTGGTATGTGGGACAGCTGCCGATGTTGATGCAGCATCGCAGATGCT
GCTTGGTTCCAGTTGACGTACGAAGAGTTGTAGTTATTGTCATATTTATAGAGATAGATCTACCTGAATTTATAGCTGTT
CGAACAGAACAAAAAAGTAAACTTGGCTGCTTCTAGGTGACGTGGCGCTTACTACTGCCTTTTGGTTACAAGATACAGTG
GTACTGTTGGACCATGTAAGCAACTGTAATACGTTTCGACTACGCAGCATCATTCTTACCACTTTTTACAAGCTTTCTAA
AAAATTGACAAGTGGCCATCATTCTCTCCATTTGATAGCATCACCTGTGAGTTTCCTACAGCAAGGCCGTCTTTTCAGGC
CAACCGCAGAAAGTTATGTCATCCACAGGAGAAAACAGACCAAACAGGACAGATTGGCTGGCCTGGCTTTGTCTTTGTCT
TGTGCGCAATCAGAAGAAGGACGGATACGAAGACATCCCGCTAAGGTCGCCCCTGCCATACGTGGACGGCCGGACAAGTC
CAGAAGCCAACGCAGCCGAAGCCGATCCTGAGGCCGCCGTGCGCGCCATTAGCCATGCCATCCGTACTGCTGCCACAGCC
AGTGCCACAGCCAGTGCCACGGTTGTAGCCACGGACGAGTATGCGGATGGTGTGAGATGCTATTCCGAAGAAGACAAAGC
CGCAGCCAAAGCGATGGGGGATGTCCTTGTCAGCATGATCACAATTACGGGGAAACTATGTCTGGGGCGCAAAGATGCGG
CGAAAGTGACGGAGGTGTGGCGCAGGCTCTTCTACGACATTGGGACGCCCATGGCAACGAGGCTGGCGGCGGGTGAACAA
GCGATAGCTATCAAGACGCTTTACTGGGCCGAGCTGGGGACGAAGTACGAGCCATACAGAAAAGACCTATCGACGAAGCA
GAAGAGGGCCATTCCAGCAGAGAAGGAGGCGGAGATGATGCGAGAGTTCTACGAGGTTATCGCGGCTGTGCCGGCAGCAT
CAGCACCAGCGGTGATGGCGGCGATGAACAAGAGCCTTGCCACGGTAGCCCAGGCACTTGCCACGACTGTGCAAGTTGGC
AGGTCGTCGGTGGCCACAGCGTATACGATCTATGCACGGAAAGTAGCTGGGGACGGGCTTGATACTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62