GenePrediction:GLEAN_864 Details

Name: GLEAN_864
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:470444..474991 (+ strand)
Length: 4548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:470444..470479 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_132:470732..474138 (+ strand)
Length: 3407
Type: CDS
Source: GLEAN
Position: GCSC_132:474352..474424 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_132:474500..474991 (+ strand)
Length: 492
>GLEAN_864 class=GenePrediction position=GCSC_132:470444..474991 (+ strand)
ATGAGCTGCCTCAGCGATGCCTCTATCGGGCCAGCGGTTCGTGGCTGTCGCAATGATTTTGATTTCACATTGACCTTTGA
GGATGCATTCTTTACTCTTTCACCATCCTTGGTGTTCATCGGTCTCTGCTTCCATCGTCTTATCAAACTCTGGCGCTGCC
ACAGGATTGTTGGCGGCGTTCGATTCTTAGCGGTCAAACTGGTATTGCTCTGTAGCCCGTCTTATGTTTCACCTGCATCG
AGCATGCGTCAATAGAGCCACCCGTTCATCTCTAACATTGACAAATAGTTGCTTGCCACAATCTACGCGGTACTTAGTCT
TGCTCTCGTTGTCATCATATCCATACAGACATCGCACGCGCTTGTCCAAGGCCGCCTCTCTCTTGTTGCAGCGTCTCTCG
GCTTCATTGCCGCCTTGACTCTGGTGTTGCTGTCGTACCAGGAACATGCGCGGTCACCCAGACCATCCATCCTCATCGTG
ACCTACCTCGCCATTACCTGCCTTTTCGACGTGGCCAAGACACGAACCTTGTGGCTGCTGTTCGACGGGCCATCACCTCT
AGCAGCCATCTCAACAGTAATGGTGGCCCTGAAAGTGGTCATGATACTTGTCAAATCGCAGAATAAGACGAAATGGCTTA
CTTGGAGCGACTCGAAAGAGCATAGTCCCGAGGAGACGAGTGGAATTTTTGGCCTCGTTGTCTTTTACTGGCTCTACAGA
CTGTTCATGAATGGCCATCGAACCATTTTGTGTAGCGAAACACTCTTCCCGCTGGACCAGGCTGTCTCGGCATCCGTGCT
CGCACCTAAGCTCGCCAAAAAACTTCGGACATCGTCGTGGAGGGGGCGCAAATGGGGATTGGCCAAAGTGCTGTTTTCCA
CGCTGGCCCCGCAGCTGTTGCCACCTATTATTCCTCGATTGGCTTTGCTCGCTGCCAGCATGTGTCAGTCGTTTCTTATC
GAGGCTCTCCTTGACTTCCTGCAAGAAGACTCAGAAAAGAGCCACGGATACGGGCTCATCGGTGCTACGATTTTGACGTA
CGGTCTCCTTGCTTTGTCAACGGCTTTGTATGGATACTTCCAGGAGCGCTTCGTCATCATGACGCGCGGATGCCTGATCA
CCGCCATATATGATCAGACAGTCCAGCTCGAGCTCGCCTCGTCAGCCGAATCTGGAGTTCTCACTCTAATGAGCACCGAT
ATCAGCCGTATAATGACGGGTTTTCTAGACATCCACGAGTATTGGGCCAGTTCCATCCAGGTTGGCCTGTCGTGTTGGCT
GCTACAGAAGAAGCTGGGGACAGCCTTTGTCGCACCCCTCGTCGTGGTCGTGCTGAGTTTCCTGGCCATGTTCTTCTTAG
GCAAGGTCGTCGGTCGTTGCCAGAGGGCTTGGATGGAAGCCGTTGGCATCCGCGTGGGCACCATGGCCACTGCAATCTCC
CAGATGAAGCTGATCAAAATGTCGGGAATGGATGCCCCCATCAAGAAGAGAATCCAGCAGCTGCGCATTGCAGAGATCCG
AGTCGGTGAGCGTTGGCGCATGCTGGCCGTCACGGGAGCCGCTATCTCGCAGGTCCCGTTGCTGATATCCCCTGTCTTGG
CATTCGCCACTGCCATGAAGACGTTGAACACTACGTCTATCTTCGTTTCAATATCTTACCTTACTCTCCTTGCGGCCCCA
CTGTTGGTGCTCTTCCAGAAGGTGCCCCAGCTTCTCAGCGCATTCACATCCCTTCAGCGCATCCAGGAATTCTTGGAGCG
CGACACCAGAAAGGACTATCGCATCTCGCATAGCCACAGCATGTTTGCAGACATGGGAATGGAGGCGCACAACGGTTTTG
ATATGAACTTATTGGAAGGAAGTGGAACCAGAGATTCCTGCATCAGTATTTGTGACGGGGAATTTGGATGGTCTCAAGAC
ACCCCGGTTCTCAAAGACGTCAACATTTCCATCCCGGCCTCTTGCCTTACCGCTGTCCTTGGACCTGTTGGAAGTGGGAA
AACGACTTTTTGCAGATACATCCTCGGCGAGTTACCTTTTGCCCGTGGCTTTGTCCATCTTTCGACTCGTAGAAATATCG
GCTATTGCGACCAGCAACCATTCTTGACAAATGCCCCGGTCCGAGACAACATAGTGGCGTATGGCGTCTTTGATCAAGAC
CGATACGATGGCGTCGTTATTGCGACCATGCTTGACCGGGACATCGCTTCCTTTCCCCAAGGCGATCTTACGGTTATTGG
AAGTGGCGGCATTGCTCTAAGCGGCGGACAGCGGCAGCGCGTGTCCATGGCAAGGGCACTCTACATGGCGGACACGGATT
TGCTCGTATTTGACGACGTTCTAAGTGGTCTGGATGCCCTAACAGAGAGTCGCGTATTGCAACGCGTTTTTGGACCAGAC
GGCCTGCTGAGGAAACGTCGCGCGACGGCGATTCTATGCACACACAATCCAAGGCATATCGAATTCGTCGACCGTGTCAT
CAGACTTCATGAGGGCGGTCGTGTCACGGAGGAGGGCTTGCCGGCCTCGAAAAAGATGGCCACGATGCCTACGGCAGACT
CGCAGTCCGACACTACCATCCCATCCGGAGCCGAGCTATTGGCGACAATTCCCACGCAAACGGAGACAGAGAGTCAAGAC
GTGGCTCGCAAGAGGCGCGATCTCAAGGTCTACGGCTACTACTTTAGCACCGCTGGGAAAATCACCCTGGTTTCTTTCGT
CTTTACATCGGCGTGCTATAGTTTCTTCTTGAACTTTCCGCGCATATGGCTCACCTTCTGGTCAGATGATGCGGCTAGGA
AGGATGGCGGGCTTCGTCAGATGCACTCTCGAGGATACTACATTGGCATTTATGGACTGCTGCAGCTCATGTGCCTCATG
TCATTCTCCGCTGCTGCAGCGCTTGTTCTGGGACCGATGATCCGACAGAGCGGGTCGATACTCCATCGGCGAGCGCTCGA
TACAGTAGTGAATGCGTCGCTGCAACTCTTTGTAAAGACGGATCTCGGCGTCATCACCAATCTGTTCTCCCAGGACATCA
CTCTGATTGACGGAGAACTCCCTTTGGCATTTCTCAATCTTGTTTTGGATATATTCAGCGTCATCTTCATGGGCGCAGTT
ATCATAGCGTCGACCCCATGGCTGGGTTTGACGTACCCTGCCATAGTAGGCATTCTCTACGCCATCCAGCACTTCTACCT
CTTCACTTCGCGGCAGCTGCGCCTGCTGGATCTCGAGGCTAAGAGCCCGCTATACTCTCACTTTGTTGACACGCTGAAGG
GTATCTCAACGATACGCGCCTCCGGCTGGACGGACAAGAGTATCGAGAAAAACCTTGCCCTTCTCGACCGATCTCAGAAA
CCGGCATACCTGCTTGCTATGGTGCAGAGGTGGCTCTACCTAATGCTCAACACGGTCGTGATGCTCATTGCGATAGTCTT
GGCCTCCATGATGACGCAGCTCCGCCCAAGCTCCACCTTGTCGGGTGCCTCTCTCGTCACGCTCATGAGTCTCAGTCAGT
CCCTGGGTGACATCGTGCGCTTCTACGCCTCTCTGGAGACTTCCATTGGAGCCGTTACTCGTCTGAGGAACTTCTCTATG
CAGACACCATTGGAAAAGTCTGACGGTTTTCAGCCAGACCACAACTGGCCATCCAACGGCAGCATAGAAGTTTCAAAGGC
GTGGGCATCCTATGGGTGAGAAATAAGCCCATTGTCAATAATCGGTTAATAAAATACTAATAATCGAAATATTTGTAGCA
ACAACTTTGATTTTGCTCTCCGTGGAGTTGACATGACTATCCGCAAGGGCGAGAGGGTTGCGCTTTGCGGTCGCACAGGA
AGGCAAGCATAAGGCTTTCTTACCGAGCTGAGTCTTGATACCTGCTAACCTAAGACATGAACATACAGTGGAAAATCTTC
CCTGATTCTCCTCCTTTTGGGGTTCATCGACCCTGTGGAGCACGAGGGGGTACAGGGCAGCGTTAGTATAGATGGCGTAT
CTCTGTCCTCCATCGATCGCCAGCGACTCCGCGAACAGCTAATCACTCTCCCGCAGGATACGGTGTTCCTACCAACGGGA
AGCACCGTGATGGAGAACCTCGATCCCGGGGGTGTAGCAACTCCGGAGCAGTGCCGTGAGGCCCTGGAGGACCTTGATCT
GTGGCAGCCCGTTCAGCTCCGAGGAGGCCTTGGTAGCCTGTTCGACGAGAGTCTCTTCAGCCATGGACAGAGGCAGCTCT
TCAGTCTCGCCCGTGTGGTCCTCAAGAGGAGATTGATGGTAGCGGGAGGAGGCGGTGCGGTGCTCCTCCTGGATGAGTTC
TCTAGCTCGGTCGATGCCGTTAGCGAGCAGCGGATGATGGTGGCTGTCGATAAACATTTCTCAGGCTGCACAGTCGTCAT
GGTGGCCCATAGGCTGAAGACGGTGACCGAGTTTAGCGACCGGGTCTTCGTCATAGACCGGGGACAGGTAGTCGAGTCTG
GTGACCCGCGGGTATTGGGAAGGATGGAGGGAACGTGGTTTGCTTCGCTGCTCAAAGCCTCGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62