GenePrediction:GLEAN_866 Details

Name: GLEAN_866
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:485508..487916 (+ strand)
Length: 2409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:485508..487367 (+ strand)
Length: 1860
Type: CDS
Source: GLEAN
Position: GCSC_132:487423..487663 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_132:487744..487916 (+ strand)
Length: 173
>GLEAN_866 class=GenePrediction position=GCSC_132:485508..487916 (+ strand)
ATGCTTCTCGACGGATCTCAGTCTGCTGCTTTGAATGGCCTCTGCTCGGGGGATCGTATTGATCTGATGGACACAATCGA
TAGTCTTCGGTCACAGGGGATCAACCACCTTGTATCGCTGCCACAGATCATTGTGTGTGGTGATCAGTCGTCTGGCAAGA
GCTCGGTTCTGGAAGCAATCTCTGGTGTGCCTTTTCCTGTTAAGGGCAACTTGTGCACCCGCTTCCCCACAGAGCTTGTC
TTGCGCAGAAGCCCTGACGTCGGCGCCACCATCTCCATCATCCCGGATCACTCTCGGAGCGCTTCGGAGAAGGCGGGCCT
GGCCGGCTTCCACGAAGAGCTCAAGGACCTGGTCGGCTTTCCAGATCTGCTCGAAGACGCTAAATCTTCCATGGGAATCT
CGACACATGGAAAGTCCTTCTCTAAAGACATCCTTCGAGTAGAGATATCGGGGCCTGATCGTCCTCACTTGACGATTGTA
GACCTTCCCGGACTCATCCATTCGCAGACAAAGAACCAAAGCGCCTCTGATATAGAGCTGGTGCAGGATGTTGTCCAGTC
GTACATGAAGCAGCCTCGGAGCATCATCCTCGCCGTCGTTTCAGCCAAAAACGACTTTGCCAATCAAATTGTTCTGAAAC
TGGCTCGTGCAGCCGACCCTCAAGGTGACCGTACCATGGGAGTCATCACAAAGCCTGACACCTTACACGCAGGATCGACA
AGCGAAACTCTCTATGTGTCCTTGGCCCAAAATCAGGAGGTTGAGTTCCGGCTCGGATGGCACGTTTTGCGAAACATGGA
CTCGGACTCGGAAAAAGGAAAAGGCACACTAACTCAGCGTGACGCGTTGGAGAATGGGTTCTTCCGCGTTGGAGTCTGGG
CGGAGCTTCCTAGCACCATTCTGGGGATCGAACAACTGCGCCGCCGTCTGAGTAAGGTTTTGCTGTCACACATCGGCTCA
GAGCTACCCAGCCTGGTAAAGGAGATCGAAACCAAGCGCAGCGCCTCATACGAAAGTCTTGAAAAACTAGGCCAGCCCCG
AATCACCCTGTCGGAGCAGCAGCTATATTTGCTGGGAGTCAGCGAATCGTTTCAAAAACTTGTTACAAGTGCCGTCAACG
CAAATTGCAACGACCGCTTCTTCCAAAATGTGGACACGGACCACGGCTACCAGCAACGAATTCGCGCAGTCGTGCAGAAT
CTGAATACAACTTTCGCCAATGATCTCCTCGAGAAAGGCCGGCTTCATATCATCAACGATGGACTGGCCGAGACGCCTTC
TTCCAAGGACGCTGCCCAGATCAGTCGAAGCGATTATGTAGATCGTATAGAGGCGAAGATGCGCAGGTCGAAGGGGCGAG
AGCTGCCCGGCCTCTTTGATCCCATGATTGTTGCGGATCTCTTCCGTGAGGAGGCAGGCCCTTGGGAACAGCTCACGCGA
GTTCATGTTCGCCGCGTTTGGAGGGCATGTAAAACGTTTCTCAAAACCGTTGTAGAACACGTTGCGGATACTGAGACATG
CAATGCGCTCATGCAAAAGATTGTCGACCCTCAGATGGCTAATGTCATGGCTGTCCTCGAAGCCAAGACAGGCGAAATTC
TGAAGTCGCATCAAACAATCCATCCTATCACTTACGACAACTGCTTTGCTGAAGCCGCTCGGATGATTCGAGAGGACAGG
AAAAAGGCTGAATGTGCCTCGGCAGTAAAGAAGTACTTCGGCGTCTCGACTCTTGATCCGAGAAACGTGCATGTTGATCT
TTCAAAGCTTGTTGATGCGATTGTGGAAGGTATTACCGAGCTGAATACGAACCGCCAGACGGCCTCGGAAGCTCTGGATT
ACATGGAGTCATACTACAAGGTGCGGAGGACTTGTTCCCAAACTGCAAGCTGAGCTGACGAGGGATCAAATTTAGGTTGC
TTTGAACCGATTCATCGATGACGTTGCAGTTGAGGCCATCGAAGTCTGCCTGGTGTCATCCCTGGCTAATGTGCTGTCTC
CAACTGGGGTGTACAAGATGAGCCCCGATCTTGTGGCTATGATTGCGGGCGAGTCAGAGGACATCCAGGCTCGAAGAGAC
CAACTTGTCCGGCAGCTTGATGTCCTGAGCAAAGGTGCTGAGATATGCAAGGGATATGTGGGTACGAATTTCAGTGGTAG
GTTGGACAAGCACCTGAAGGATCAGCACGACAGCTGTTTGATGAAGAGTCCATCGCTAACGAGGACAATATCAAAGATGG
CGGTTCATCCTCTTTCTCAGATTTCGAGTCCCATCCCGACGCCTCTGAATACGATACAGATCCAGGGCAAGTGCCAACAC
CGGAGCCTCTTTCCGAGGCCAAGCCGGCGTTTTTTTCCACTTGGGACCAGATTCGAAAAGAATCGAAAACATACAAAAGG
GGCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62