GenePrediction:GLEAN_86 Details

Name: GLEAN_86
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:565650..566968 (+ strand)
Length: 1319
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:565650..565690 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_179:565774..566682 (+ strand)
Length: 909
Type: CDS
Source: GLEAN
Position: GCSC_179:566797..566968 (+ strand)
Length: 172
>GLEAN_86 class=GenePrediction position=GCSC_179:565650..566968 (+ strand)
ATGCCTCACAAACACACCCGCCGGGAGCGGGATCCATCCGCGTGAGTATCTAGCGGCCAATCGCAAATGTTTCATGAGGA
GCATTTCGTATGTCTCTGACCAAAGCTAATACTGTTCGTGGCAGCTTTGATCTCCCGCCGACCGAAATAGCACGTCCTCT
CCCCGTGAACAAGTCCTCTCGGGGCGAGACGGCCCCGCCGAAAAAGGGCTCCAAGGCGGCAACGGCAGCAGCAGCGGCAG
CGGCAGCAGTCAGCACTTCGCGGGGGACGAAGCGGAAGCGAGCAGCAGCAGCAGCAGCAGCGAGCAAGGACGATGCGCCA
CGGGCTTTCAGACGGCTGATGGCGGTGGCTGGTGGCAAGAGGGTGCGATCGGGGCTGGACGACGGTGCGATCGAGGCTGC
CAAGCAGGCCAAGAAGAGCAAGAAGGAGAAGAAGGCGGCAGCAGCAGCGGCAGCAGCAGCAGAAGCGGCCGAGGAGGGCG
ACGTGTCTACAGGTGCAGCCAAGGCATCAGCAGCAGCTGCAGCAGCAGCAGCCACAGTAGCGGCCGATGCCCCGGAGCCG
CTCAAGATCCGGCCGGGCGAGCGGATGTCCGACTTTGCGGCGCGCGTGGACGCGGCACTACCGATCAGCGGACTCGTGCC
CAAAGGCAAGGCGGCCAGCGACCCGCTGGGGCTGGAGAAGGCTTTCCGGACGAAGAAGGAGCGCAAGATGCACAAGCTGT
ACGCGGAGTGGCACGAAGAGGAGCGGCGGCTGCAGGAGCGGCGGGCCGAGGAGCAGGACCTGGCCGAGGAGCGCGAGATG
GAGCTGGACGAGAGCGTCGGTGTCAAGTGGCGCCTGGACCTGCAGCAGTCGGTCAAGAAGGCTCAGCAGGCGGCCGGCGG
TGGCGGCGGCAGTGGCAGCAACAGCAAGCTAGACGACGACATGTGGGCGGAGCTCAACCGCAAGCGGGCCGCCACCGCTG
CCAAGGCCGTTCGCGCCGGCATCCACGACGTCGTCACGGCGCCGCCACAGCTGACCAAGATCAACAGCGAAAAGTTCTTC
CAGAGCCGGAAGCCGGGCCTGGAGGCGGCGGCCGACAAGGCGGCGGCAGCGGCAGCTGCGGCAGCATCGACGGCACCGAG
ACTCAAGAGACGACCAAAATCGACCAGGGTCGTGCTCGACGACGTGCCCCGGTCGGTCGTCGACCCGGTCGCACGCCGCG
AACTGCTGGCCCAACGACAGGACGTGCTGCTGTCGTACCGCAAGGCGTCAGAGGTGCGGCGACTGCAGCACCAGAAGCAG
CACCAGAAGCCACAGAAGCCGCAGAGGCGGGAAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62