GenePrediction:GLEAN_870 Details

Name: GLEAN_870
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:498282..501060 (+ strand)
Length: 2779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:498282..498369 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_132:498416..498483 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_132:498532..498782 (+ strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_132:498838..499037 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_132:499129..499946 (+ strand)
Length: 818
Type: CDS
Source: GLEAN
Position: GCSC_132:500269..501060 (+ strand)
Length: 792
>GLEAN_870 class=GenePrediction position=GCSC_132:498282..501060 (+ strand)
ATGGAGAAGCACGCCATCACTACGGACACGACTTTGGCTGCCGAAATCAGCCAAGTCATCCTTTCGCCCGCCCTCGAACG
GGCATACGGTAGGAAAGCCAGCCGCACCCGCTGTGACGTTTGCTGATTATCCAGTCCGCAAGATGGATCTCTGGCTGCTT
CCCTTTTTGAGTGCCATGTACTTTTTCAACTCCATCGACCGGGTATGTTGATGCACACACACGCACCCAAACACACCCGC
TAACCGTCAGAGCAATCTGGCCAACGCCCAGACCGATGGCATGGGCAAGGACTTGCACCTTGTCGGCGAGCAGTACTCGC
TGCTCGTGCTGCTGTTCTACATCCCCAACGGCCTGTTCGACCTGCCCCTGAACCTGCTGACTAAGCATTTTTCCGGCCGC
ACGGTGTTGCCGGTGCTGATGACCGGCTGGGGTGCCATGTCGCTGATCCAGGTGGGCTGTCGCAGCTTTGCGAGCATGCT
GGTGGTGCGGTTGATTCTGAGGTAGGTGGTATCGGAACGAGCGTGGAAGAGAAACCGTGCTGATGTTCGACGGCAGCGTC
TTTGAGGCCGGCTTTTTCGCCGGGACGGTCTTTTACCTCACGCTCTTCTGCACACGTGGCGAGCTGGGCTTCCGGATTGC
GCTTTACTTTGGCAGTGCCTTGCTGGCAGGAGCTTTCTCTGGTGTGTTGGCCTTTGGCGTCTTCCAGATTGACGATCCTC
ACGTCAAGGGTTGGCAGTGGCTCTTTATTATTGAGGGTGAGTCTTGTCTCTGACCTATATCAGTTTTCATTGGTGTTTCT
GCTTTTCCTCCATCCGTCACCTCCCTCCTCTGGTCTAACCTCACCAGGCGGAATGACTGTACTCTTTGGCCTCGCCGCCT
TTCTGTGGCTGCCAGCAAGCCCGCAGACAGCCTGGTTTCTGAGTGCAGACGAGAGGGCAGTCGCATCGCAGCGCTCTCTC
CGTGACGGCTCCTCGGCCGTGGGCGAGCGCCTGGACTTGCAGGCCTGTCTGGCGACGTGGCGCGAGTGGCAGTTTGCGCT
CTGGTGCGTCATCAGCTTCACGTACCCGGTGGCCTTTGCGACGACAGCCAACTTCCTGCCGCTCGTTCTGCGCCGCCTCG
GCTACAGCACGGTCAAGACGAACCTGCTGACAGTGCCGCCGAACGTGGCCGGCTTCGTCGTGTTGCTGGCCGTGACGTAC
AGCTCGGATCGTCGTCGTGAGCGCACGTTTCACATCATCGGCAGCCTGCTGCTCAGCCTGGCCGGGCTCATCATCCTGGT
GGCCATCGACGCCGAGGCGCATCGAGCTGTGGCCTACTTTTCCTGCTTTCTTCTCTGCTCGGGGGCCTATATCCCCAGCT
GCCTTGTGCACAGCTGGCACAACAACAACAACCTGCGGGAGTCGTCGCGGGCGGCGACGACGGGCCTCCTCGTCGGGCTT
GGCAACATCGCCGGCATACTCTCGGCGGCCACGTTCCGCACCCAGTACGCGCCCCGGTATGCGCCGACACTCATCGCGAC
AGCCTGCTGCAATGTCGTTTGCATCGTCTTCACGCTTTGGCTAGGGCTCTGGATGAGGGCAGAGAACGGCCGGCGGGATC
AGGCGCAGGGTGTGCGGCTATCGGCCGAGCAGGTGGACACGCAAGAGCTAGAGGGAGTGAAGGATGTGAGGTTTCGATAC
TTTGTGTAGGTGATTGTTATGGTCAGAATTGGCAGAATAGGCAGAATGGGCTCGATATAGACTTGTGCAGTGATAGAAAG
ATTTGTACTATTTAGGGCAAGCGTGTATGCATTCATTCATTTAGTTACTGTTTGTTGCAACAACACTTGTTGGACATTCG
TATCATACTACTCGTTTGTCACGCCTCGTCCTCACTCCTAGTCACTCCACGGCACGTTGTCATTTGTCATTTATTACTAA
TCTACCACTTAGTTACGCCTCCGTCGACGCGAATGTCGGTTCCAGTACAGTACCTGTTTGTTAGCAGAGTTCGATTGGAT
ACACACACACAGAGTACTCACATGCTCGCATCGCTCGCAAGGAAGACGGCGGCGCCCTTGATGTCATCTGGCTCGGCGAC
GCGATGGTTCATGATCTCATCCTTCCAGCTCTCGAGCAGGTCGGGAAACGGGGCGGTCATCTCGGTGCGGACGTAGCCGG
GGCTGACGGAGTTGACACGGATGCCGTACTGGTGCAGCTCGGCGGCGATGGGCGGGACCATGGCGCGGACGCCGCCCTTG
GTGGCGCAGTAGGCAGACGACCACTGGGAGCGGATGGCCATGTAGGAGGCGATGCTGGCGACGAGAACGATGCTGCCGCA
CTTGGTGCCGTTGGCGATCATCTGCTTAGCGGCCAGCTGGGCGGTGAAGTAGACGCCCTTGACGTTGACGCCGAGCAGGC
GCTCGAAGTTGGCGGGCGTGGTGTCGAGGAACTGGACGTGCTGGTTGACGCCGGCACAGGCGACCAGGATGTCGAGACGG
CCGTCGAAGTCGGCCTTGAGCTGGGCGAAGCCGGCCTCGAGAGCCTCGTACGAGGTAACGTCGACCTTGTAGGCCTTGGT
CTGAACGCCATACTTGGTGGCGATCTCGGCAAAGCCGGCGACAGGGTCGAGCACGTCAAAGACGGCCACATCGGCGCCGG
CTTCGGCGAGACCCTGGGCAAAGGCCAGACCACAGCCACGAGCACCACCGGTCACGAGGGCCATGCGGCCTTTGAGCGAG
AACTGGGGTGTCAGCGGGCGTCGAGATGGAGGTGGGAGGCTAACTCACCTTGGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62