GenePrediction:GLEAN_872 Details

Name: GLEAN_872
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:503124..504304 (+ strand)
Length: 1181
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:503124..503225 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_132:503592..504175 (+ strand)
Length: 584
Type: CDS
Source: GLEAN
Position: GCSC_132:504262..504304 (+ strand)
Length: 43
>GLEAN_872 class=GenePrediction position=GCSC_132:503124..504304 (+ strand)
ATGAGACTGCTCAACGCCCGCACCCTGAAGATGGAATATTTTCTGTCCGAGGACGACTTCCCACCGTTCGCAATCTTGTC
CCACACCTGGGGCAAAGAGGAGGTCAAATTCGCCGAGATACTCTTGCCTGGGACAGGAGAGGGATGGACGAAAATAAATT
ATACCTGCCAGCAGGCGATTCGGGATAAGATCGACTGGGTCTGGATTGACACGTGCTGCATCGACAAGAGCGACAGCGCC
GAGCTCTCCGAGTCAATCAACTCCATGTTCCGCTGGTATCAGATATCTACCGTCTGCTATGCCTATTTAGCCGACGTGTC
GGTCACAGCCCGCCAAAGAAATGAGCCTGTATTCGAATCAGACATTAGCAGGAGCCGCTGGTTCACTCGTGGCTGGACTC
TTCAGGAGCTGGTTGCGCCTAAGATTGTTCGATTTTACTCTAAGAACTGGGAGTACATTGGTTCCAAGACAGACTTTTGC
AGCCTGCTCTCGTCCATTACACGTATCGCCGAGAAGTACCTCACCGGACACGATATTTTCACAGCCAGCATCGCCCAGAG
AATGTCCTGGGCTTCACGTCGCCAAACCACTCGCAAAGAAGATATCGCCTACTGTCTCTTCGGTATCTTCGACATCAACA
TGCCCTCGGTCTACGGAGAAGGTACCAAGGCCTTCCGGAGGCTCCAGCTTGCCATTATTCAGGCTTACCCCGAGGACCAC
ACCATATACGCCTGGGGGGCCGTTGTTGAAAAGGTCTCTTGGCTGTATCCGGAGGACAAGGCCTGGGCTGACACGCCTCC
GAAATGGGAAGATGCCGAAGAACGGGAGGAGCTCGGACTGTTGGCGAGCTCCCCCAAGGACTTTGTTGAGTCTGGTCTGT
TTGTTCCAACCCCGTTTGGCTCCGATTTTTATATGTTAAATCAGTACGATGCCAAGCTTCCTGCTCAGATTGGCAACACG
ACCATCCGCCTGGACCTGCCAGTGTATCCTGGTGTTAGGCTGTGTCTCCGCAGACAGCATGCGCTACAGATGGCACAACT
TCGCTATGTTTGGTATGCAGCACTGTTCTGCGGTCTCGAAGGTGACTTTATGAGCACCGTGGCCATTCCTCTGGAAGGCA
ATGATCTGGACTCAACAGTTCGCACTCGCGAGATAGTTCGCTGTACAGACCCCGCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62