GenePrediction:GLEAN_873 Details

Name: GLEAN_873
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:511750..513603 (+ strand)
Length: 1854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:511750..511970 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_132:512021..512285 (+ strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_132:512338..512538 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_132:512601..512960 (+ strand)
Length: 360
Type: CDS
Source: GLEAN
Position: GCSC_132:513064..513603 (+ strand)
Length: 540
>GLEAN_873 class=GenePrediction position=GCSC_132:511750..513603 (+ strand)
ATGAGCGAACAGCAGCCTTGGGAGGAGGTTGTCGCCCGCAAACAGAAGCAGCGGGCCGAAGCCCTGACCCCATTTGCTGC
ATTCCCTACTTGCGATGCCATCACAGACGAGGACGATGTGGCAACACTCGCCGCCAGCATTGTGTCTGGCAAGCTGACGT
CCGAAGCCGTCACGAGGGCATACATTGCGAGAGCATATGCGGCACACGAGAAGACAAATTGGTATGTCGTTGGTGTATCT
TCGCGCTCTATCGGCCGTGCTGACCAGCCAGTCTGACCGAGGTCTTCTTTGCAGACGCCCTCAAGCAAGCTGTCGAGCTG
GACCGACATCTGACTGCTCATGGAAAGCCCGTAGGACCGCTGCACGGCGTCCCCGTCACACTCAAGGACCAGTTTGACGT
CCAAGGCTACGATTCGACTATTGGCTACGTCGGCCGCGCGTTTGCCCCCGCCGAAGCAGACAGCGTCCTCGTTGCCATTC
TGAAGTCACTGGGGGCTGTCATCCTGGCCAAAACTAACCTGCCACAGAGTATCATGGTTCGTCGGGGGCCGAGAAGACCA
GACGACTGAGCAGACATCCTGCTGACAGCCGCAGTGGTGCGAGACCGAGAATGCCATGTTTGGCCTCACCGTCAACCCCG
TCGACAAGACCTACACGCCCGGTGGCTCTACGGGTGGCGAGTCCGCCCTTCTGGCATCGCACGGATCTATTCTAGGCTGG
GGCACCGACATTGGGGGCAGCATCCGCATTCCGTCCCACATGCTAGGTCTGTACGGCCTAAAGCCGAGTGTGCGTACTGT
TTGCTCTTCTGACTTGCACAATTGGCCTTCTTCGTCATGCTAACGTCACAGAGTGCTCGTCTCCCATATCGTGGCGTGCC
TGTTTCGACCGACGGCCAGGAACACGTGCCTTCGTCCGTTGGCCCGCTGGCCCGCAGCCTCGACAGCATCCGCCTGGCCA
TGGAGTTCGTCATCGGCCAGCGGCCGTGGGACAAGGACGCCCGCTGTGCGCCGCTTCCCTGGCGCACCTCCATGTATGAC
GACGTTCTGAACCGGCCGCTCGTCTTTGGCGTCCTACGCTACGACGGCGTCGTCCGTCCTCATCCGCCCATCGCCCGCGT
GCTCGACGAGACGGTCGAAAAGCTCCGTGCAGCCGGCCATGTCATTGTCGAATGGGATGCCTCGTTGCATGCAGAACTGA
TTGCAGTTATGGTGAGTGGGGGGGGGGGGAAATGAGAGAAAGAGGGAAAAAAGGAGAGCAATGAAAAAAAGAAAGAAAGA
AAGAAAGGAGAAAACAACATAACTAACCCCACAGGATGCATTTTACAGCGCTGACGGCGGCGAGGATGTCCGTCGCGACG
TCGCCCTCGGCGGTGAGCCTTTTATCCCGCACGTCGCCCGCCTCGTCGACCGTGGGCCCGCCATCTCCGTCTACGCCTAC
TGGCAGCTCAACCGCCGCAAGATGGCCCTGCAGCAGGCGTACCTCGACCGCTGGGTGGCCACGGCCTGCGACGCCGTCCT
GATGCCGCCTATGCCGCATACTGCTGTTCCGCACCGCTCCTGCGGCTGGGTAGGCTACACAAAGGTCTGGAACGTGCTCG
ACTACCCGGCCCTCGTCTTACCCGCCGGCACAGCTGCGCCCAAGGACCTCGATGCGCCCTGGGATGGCGATAGCCGGCCG
CTGCTGTCCGGTCATCCCATGGATGCGGCTAACCGCGCCATCTGGGCCGAGCATGGCGCCCGCATGGCCGCCCTGCGCCT
GCCCGTCGACGTGCAGGTTGTGTGCCGCAAGCTGGAGGAGGAAAAGGTATTGGGCATCGGCAGGGTGGTGGACGAGGTGT
TACGGCGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62