GenePrediction:GLEAN_874 Details

Name: GLEAN_874
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:526851..528736 (+ strand)
Length: 1886
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:526851..527042 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_132:527111..528287 (+ strand)
Length: 1177
Type: CDS
Source: GLEAN
Position: GCSC_132:528358..528603 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_132:528651..528736 (+ strand)
Length: 86
>GLEAN_874 class=GenePrediction position=GCSC_132:526851..528736 (+ strand)
ATGAAAGTCAAAGACACTCAGCCTGAATCGGTCGTGCCTGAGAAGGTGAAGGATGAGACTTCGGTGGCCAGCTCCCTCCC
CCCGGCCGAGGACGAGCCGATCCCCCATTTGCACGCAAAAACGTTTTTGACCGTCTTTGCCGTTTGCACTGTCTATTTTG
CCCAGCTTGTGAACGTGGTCGGAGCCGGAGCAGTAAGGCCCAGTACCAGAGCTGATCGACACGAAAGTAGCCAACTGCCA
GCATTCACTAACCCCCCCAGCAAGCACAGAAGATCGTCGAGGTCGTCGGTGGCAACACCAACAGCGTCTGGCTGACATCG
ACAATTGCCATCCTGACGGCGGTGCTGTCGCCCATCGTCTCGCAGGCGGCAGACTACTGGGGCCGCCGCTGGTTCCTGAT
CGTGCTGACGCTCTGTGGTGTCGTTGGCTCCATCGTGGTCGCCCGGGCCGACAGCATCGGCATGGCCATTGCCGGTTTCA
CCGTCTCCGGCCTTTCTTATGGCGCCCAACCGCTGCTGCATGCCGTCGCGTCCGAGGTACTACAGCGTCGCCACCGGCCA
TGGGCCCAGGGCTTGACCAACCTGTCAGCAGCCCTCGGCGGTGTCGTTGCTCTGCTTGTCGGCGGCGCCATGACGCGCAA
CAGCAATGCCGCCGGCTTCCGGAACTTCTGGTACATGGCTACGGCTATCTTTTTTGTCGCCACCGTTCTTGTTGCCCTGC
TCTACAACCCGCCCAGGACGGCCAACCAGACCGATCTTACGCTCGGCCAAAAGCTCGGCCGCCTCGACTGGGTCGGCTAC
AGCCTTCTCTGCAGCGGCCTCGTACTCTTCTGCATGGGCCTCTCCTGGTCACAGAACCCGTATCCGTGGTCCAATCCCCA
CACGTCTGCCACCTTTGCCGTCGGACTCGCCCTTTTCCTCGTCCTCGTCGCCTATGAGACCTGGTTCAAGACCGACGGCA
TGCTGCACCACGGCCTTTTTGGCCATCGCAACTTCGCCATCGCTCTACTTTGCGTCTTCGTCGAAGGCCTCGTCTTTTTC
GCTGCTAACAATTATTTCGCCTACGAGGCCGGCGTCATCTACGAGACTGATACCCTACATGTCGGCCTCCGCTACACCGT
CAACATGCTCGTCTACGGTGCCAGCGCCATTTTTGCCGGATTCTACTGCTCCTCCACCAAAAATGTCCGCTGGCCGGCTG
CCTGTGCCTTCACCTCCATGGTCATTTTCTTCATCCTCATGGCTACCGCTACCCCCTCGGCTGCCAGCTCTCGCAACGTC
TGGGGATACCCCGTCTTTCTCGGTATCGGCCTGGGCATCGCTCTCTGTGCCCTCGTCACCATTGCACAGCTGTCGACGCC
GCGTGAACTCATCGCCATCACCAGTGGCCTCATGATTGGCACTCGCTCTCTGGGCGGCTCTGTTGGCCTTGCTATCTGTA
AGCACGGCTTTCTTGTTTGGGCTTTTGACAGAACTAATACTGTTGCCAGATAACGCTATCCTTTCAGGGCACCTGAACTC
TCGTCTGGGCCCGAATATCGCTGCAGCTGTGCTGCCTCTTGGCCTGCCCGAGTCATCGCTCGCCGCGTTCATTACCAATC
TCTCTAACCAGAACACTGCTGGCCTGCTCACCGTTCCCGGTGTGTCAACTGAAATCATCCTGGCGGCCGTTAGTGCCCTA
AAGGAAACCTACAGCGTCGCATTTCGTTGGGTCTGGACGGCTGCCGGTGCCTTTACTGTTATTGCCGCTATTGGTAAGGA
ACCCTGTGTTTCGATGATAAAACAAGACTAATCGTCACAGGCGCCACCTTTTTGATTGATCCCAAAAAGGAGTTCAATAA
TCACATCGACGCCCCGGCCGAAAACGCAGAGGAGCTCTACAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62