GenePrediction:GLEAN_875 Details

Name: GLEAN_875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:529653..531207 (+ strand)
Length: 1555
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:529653..529802 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_132:530016..530120 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_132:530199..530569 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_132:530886..531207 (+ strand)
Length: 322
>GLEAN_875 class=GenePrediction position=GCSC_132:529653..531207 (+ strand)
ATGTTCGGGCCCCCCAAAGTTCAGCCTGTGCTGGTCCTGAGCAACTTTTTCGTCGCGCTCAGCTTCGTTACTGTTTCCAC
ACGAGTGTACACGAGGCATATTGTCGTCCATGCTGCAGGCATCGAAGATTATCTGATATGCATATCTCTGGTATGTTGCA
TCTCGTTCCTAGCGAGCACCTAAGGGTCCGGCTATGCTTGCAGATGTTTGATCCTACTTGGGAAGATCTTGACGCCTATC
GTCACGCTTGTAAATTTGACAAATCACTGACCATACCTTAACGCAACAGCTCGCAGCCATTGGCTTTTTGATCGTGGAGA
TGTTTCGTAAGCTACCCTGCATTGTCCGATCGATTGCCTGCAGGAACAGTTCGTCTGGCTGACAGTGGCACTGGAACCAG
AGATCAAGTATGGACTGGGGCAACACCTCGTCGACATCCCACCAGAAAACCGAGTCAAGTTCTTTAGGGTATGCGCTGCA
TCGGCAAATTAAAAAACGGCCGACTTCAGAATTACATATTACGAAACTGACAAAAATACCTCACAGTGTCTTTGGGCCAC
AATTCCGGTGTACAACTTCTCCCTGACGTTTTGCAAGCTGTCTATTATCTTCCAGTACAAACATGTGTTTGTTGAACCTA
CAGTCCAAAAAATTTGCCGATACTTTCTTTCTTTCCTGGTTGTCTACGGACTCTGGACTGTTCTGGGCTCCGTTTTCATG
TGCGTGCCCGTCTCCTTCTTCTGGGGAGTGGGCCATGGCTCGTGTATGAACAGATTGGCGTTCTGGTTCTCCAATGCAGC
CCTCAACATCACCACTGATATTGCTATTATCTCCATTCCAATGCCACTTATTAGGAAGCTCCAAATTCCCGCTCGCCAAA
AACTCGTCCTCATGGTCGTCTTCGCATTCGGTGCCTTGTACGTGCACCCAAATCTTCGCTACCAACAAAAATGATTCCTG
CTAACACCAAGCTTACCAGTGTCTGCATTACGTCCATTATTCGATTACGTTCCCTCCTCGCCATTTCGACTTCGACCGAC
ACTCCCCGTACGTTCTACCCCTTCCCCGCGGGTTTTTTCTTTGAGCGTCGACCGATACTGATTTAATTGTGCAGATGATG
GAGTCGCTATTGCTCTTTGGAGTGTAAGTAGTGTCTTGTAATATCGTTTTGGTTTTCAGTACTTGCTAACCCGCTTTGCA
GAACATAGAAATCAACATGGCCATTATTTGCAGTTCAATGCCCGCCCTGAAGCCTTTAGTATCTTCCATTTTCCCGAAGC
TGCTGGGAATGTCCTCCGCAAACAACCGTTCAAACGGGTATAGCGAACGTTTCGACAGTCACCCCATGCGATCTTTCGCT
CAAAGTAAGAACGCTGGCATATCCTCCGCAAGCCGAAGTCGGGATATATACGTCGAACAAACATTTGAAGTTAGAGATGA
AGGCGAAATGGGTGATGTGGGTGATGGGGTCGATGGCAAGACTAGCCGAGAGGGAAGTGAGCGAAATTTGGTTACTTCAA
CTGCGGTCCAGTCGAAAGGACTACCCTTCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62