GenePrediction:GLEAN_877 Details

Name: GLEAN_877
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:538041..541383 (+ strand)
Length: 3343
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:538041..540070 (+ strand)
Length: 2030
Type: CDS
Source: GLEAN
Position: GCSC_132:540123..541109 (+ strand)
Length: 987
Type: CDS
Source: GLEAN
Position: GCSC_132:541194..541383 (+ strand)
Length: 190
>GLEAN_877 class=GenePrediction position=GCSC_132:538041..541383 (+ strand)
ATGGAGGGAACACGATCTGGACGACACCTTGGCCGTGCGGCCCCAGTTGAGGACAAGAAGTTTGCCTGCACCCATGCCGG
CTGCACGAAGCGGTTCACACGGGCGGAGCATCTGCAGCGACACGCGCTGAATCACACCAGCGGCGACTCGACGTGTCCCC
GGTGCAGCGCCCACTTCAAGCGGCCGGACCTGCTGGACCGCCACATGAAACGGCACCAGCAGAAGGACGAAGAGGCAGGT
GGAGAAGGCTGCGGCTTCCTCGACACCCGCAAGCGCGCCTGGAAGGCCTCTGACGGATCCGTCGTTGAGCGGCGGCCACA
CCCGTCAGAGCGAGGCCGCAGCTGCTCGACTGAGCACTCGGACGAATCGTTCAACGGCTCGAGCGGCACGAACGGCACCA
TCAGAGTAGCTACCGGCGACGCCGGCGACAACCACGGCAGCACCGTCGAGAAAACGTCGTCGTACGGAACGTGCTTTGAG
ACCACGGTCCCGGCATCGTTGACACAGCCGTCGGCTCGGCAGTATCCCACGTCACCGATCTCGGATCGCGCGTCGGGCGA
CCTGTCGTTCCAGGATTATAGCGGTTCAGTCAGCCAGGGCCAAGGCTTCCAGCAGCAGCAGCAACAGCTCCAACAACCAC
AGGCACAACTGCTCCAGCAACTCCAACAACCCCAACCCCAGACCCAGCCGCAACCACTCCATCCAGACCCGGCCAACCTT
GACCCCATCTTCTCGTCTCTGCTTCCAACGGCTGACGATCCTTGGCAGCTCCTGTACGAGCAGCCGTTCCAGCCAGACAC
GGCCAGCTCGTTTAACATGCCCTACACGACGGCGCTGGACTACAACTGGCTCTTTAACGTATCTTCGCCCGTTGACTTTC
CCGCTCGGCCGCCGGTTCAGCCAGGCTTTCCCGACCCTATGGCGCTACAGCAGACAGCAGCGACACCAGCAGCACCTGCA
GCCCCGTTTGCGCTCACGCCCCGCTCCAACAGCACGGTGACTAGCATGCACCACAACGGCCCCGGCGACAACCAGTCCTG
GTCGGGCTCGATGGAGGCGGCTCCCAGCCATGACAGCACCGATGACCAGATGCGATTCGCATCGCCTGAGCTGGGCTTTG
CAGACAATACATTGCACACACAGCCACAGCCACAGCCACAGCCACAGCCACAGCCACAGCCACAGCCACAGCCACAGACA
TCCGGGTCACGTGTTCCTGTCCGTCGAGGAGCCTTCACCCACGGCCAGGTCCAGAACCAGAAGCCGACATATGGACAACA
GCAGCAGCAGTTGAGCTTTGATAGCTTTCTGACCCGGGCTCTGACCGACTCGGAACGGCCGCTGTCGATGCTGGAGCCGC
GGACGCAGCTGCCGAGTATTGACCGAGTGACGCATGAGAGGCTGCTGGCGGTGATCAGCAGCGCCAAGCCGAACCTACCT
GAGTGCAGCAGTGGCCACAGCGGCGCCAGCAGCATCTCAGCACTTCGAGACCACCCGTTACTGTCCCAAACGGCACTGCA
GTCGTACCTAGATCTGTTTTTCACCCGCTTTAACGCGGCCTATCCTATCGTGCACCTGGCAACATTCGACCCAGCAACAG
CCGAGCCGCTGCTGCTGTTGGCCATCGTGCTGCTGGGGGCCACGTACGCAGCCAAAGATGCCCACCAGGTGGCCGTGTGC
ATCCACGACGTTATCCGGCCGTGCGTCTTTGCACACGACGGCTTCTCGGCCCGGCCAGAGCTCTGGACGCTGCAGACGAT
CTTGCTCGTCGAGTGCTTCGGCAAGTCGCGAGCTGGCCAGAAACAGCACGACATGAGCCACCTCTTCCACGGACTGCTGA
TCAACCTGATTCGCCGCTCCGATTGCCAGTCGGTCCGGCCACCGGGTCCGCCGTCGTCCACACGCCCCGACCACTACCAA
CAGCAGCAGCAGCATCACGGCCACCACCACGGTCCATCCGAGGGCAGCATTGTCGGACTCGCCTTGGAGCGAGCGTGGCT
GAAGTGGGCCGAGGCCGAACAGAAGAAGAGGTATGGCTTACTTTCCAGCCTGTCCTTTGATGTTTCCACCGCTTACCTGC
AGGCTCGCGCTTTACTGTTTCATGTGGGACACCCAGCACGCCGTTCTGTTCTGCCAGAGCCTCTGCATGTCCGCCTTTGA
GCTGCGCTTGCACTTTCCCTGCAGCCAGTCCGTGTGGGAGGCCCCTGACGCGGCCTCCTGGGCTGCGGCTTGGTGGAGCA
CTACGCCCGTACCTGCTCCGACGACACAGAACGTACGAAACGAGCAGCCGCAGCAGCCGTTCTACCTGCCGTCCCTACGA
GCGTACCTCATCCCAGGAGGTCCGCCGCCACCGGCCGGCCTGAGTGCCCAGTCCCGTCTGCTCGTCCTGCATGGCCTCAT
GTCTATCTGCTGGGACATGCAGCGACGCGACCAGACCAGCCTCGGGTCCGCTGTGGCATCGTTGCCGGGCACGTCGAATT
GGCGCGAGTTGATGGCGACGGCGTACGGCGCCTGGAAGGTCGACTTTGATGCCTACTGCACGGCAGTGGTACAGCAGCAG
CCGCAGATGTCGGGGCAGCGCGCAGACGAGTTTGTGGCCGAGATAGGCACGTTTGCCGCGGCAGCCAACGCAGTTTACCA
CGCAGCCCAGTGTCTGTTACGGATGGACTTCTTGGACGTCCAGATCTACGCCGGCGCCCGTCACATCCTCGGCCGGCCCG
TTCAGCAGCGAGACTACCGGCGGTCGGCCCAGGTGGTCAAGCGATGGGCCAGCGCGGCATCCTCGGAGGGGGAGAACGAG
GGCAGCAGTGGCAGTAGGGGCAACAGCAACACCACAATTCAGGCACCGATTGGCGTTGCCGATGCGGCCGGAGCGGCCTG
GCACGCGGCTCGGATGTTACGCGAGGTGGTTCCGGAGGCCGAGTCTGAGGCCATGGCTGGCATCTTCCACGTGCCGTGGT
GCCTCTACCTGGCAACGCTCACCTGCTGGGCTTTTCACCACGCGGCACCACTCGGCAGCCGTGGCCAGTCGCAGCTGCTT
CGGGACGGCGGCGCCGAAGAGGCAGTCCCGTCCGTCTTCCACGACGACGACGACGACGACGACGACGAGATCGTCTGGGA
CGCGCGCGCCGAGATGGAGGCGCTGATCACCAGCATGGCTGCCAGTCCCGACGGGCCCCTGCGGACCCGCCGTCTGCAGG
GACGCCGGCGCACCAACGGGCTCGTGTGGGTGATGGCCGATGTGCTGACTAAGGTTCGCTGGGGCATCGTCCATGCGGGC
GTATTGGTTTTGCGCGGGCTGGTGCCAACCCGGCTGATCAACCAGTACGAGGCGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62