GenePrediction:GLEAN_878 Details

Name: GLEAN_878
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:549533..551572 (+ strand)
Length: 2040
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:549533..550338 (+ strand)
Length: 806
Type: CDS
Source: GLEAN
Position: GCSC_132:550407..550603 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_132:550669..551089 (+ strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_132:551149..551443 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_132:551534..551572 (+ strand)
Length: 39
>GLEAN_878 class=GenePrediction position=GCSC_132:549533..551572 (+ strand)
ATGTCGGCCAAGAGAGTCCCGTCTTGCGAGCCCTGCCGGCTGGTGAAGCTGGCATGCGATCACCAGCATCCAGTGTGCTC
ACGCTGTATTAAACGGGGCATTGACAGCAAATGCGAATACCGGAAAAACGCATTCAAACGCATCCGGCCGCAGGAATCGC
AACGACCGTCGCCAGAGGCCATGCAGTCCTCGCCCGCAGACCACTTCCAGAGCCGATGTACCGCGGCCCAGTCGACGTCC
TCTTCGACGCCGCAGTCGCTGCATCAGTCAGATATCGGGCAGTCAGTCGTGCTGTCCCAGTTGAAGCTGTACCCCAGCCC
AGGCTTCCAGGGACCGTCTTCGCTGGCCTCAATGCTCGACAACCTGGGCCGTCGCGGCCTGCCTCCTCCCCCAGGCTCGG
AGCACGCCGGCCTCAGCAACGAGGAGGCCAGCCGGATGGACGCGCTCTCGATGAACCGCCTGTCGATGATCGAAGACGGC
GTCAGCATCCTAGACATGCTTCTGGCCGTCATGGTCGATGACTTTCTCGACCGCGTCTTCACGGCTTGGAAGGGCTGCGG
CCTCGAGTCGCACCTCGGCTCTTTCCTAGTCAGCTCCTTTGTCGACACTATGTCGCAGGAAATCAACCTGCTGCAGAGCT
CCCATAGCTGGCGTGCCAATCTGTTTGCGCTGTCGCAGCGCATTTTCGACCGTGGAAGCCAGCCGGTGGAGCTGGACACG
TCGACCACGCTCCGAGACTTTGTCAATCACTTCACCGGCCCCAGTCTGCGCTGGGAGACGGTTGGCGTGATCTTGACACT
CATTGGGTATGGCACTGCCATCTGTCGACCGCCAGCGCACGTCTTGCTAACCAGCGATTTGACAAAATTACCAGCATCGC
CGCCGCCGAAACCAGAGCCCCCAATGCCATCTGCAACAGCGAGCAAGAACGGCAGATCCTCCGCATGAACATGGTGAACT
GCGCCAACAAGTGCGCCTCTTTTTGCGAGTCCTTTGACATGTCCAACGATGTTCAAATAATTTTTCTGTATCAGAACTTT
CTACTGCAATCCGTCTTTTACGGCGACCAGAGTCCGTGTCCCCGTTTCGCTCCTCTTAAAAGCGTAACTGACCGTTATTT
ACTCGCTACTTGGCAGGTTTTAAAACCTGGCATGCATTCAACGATGCGGCAAACGCTCTGCTGGCGGCCGGACTCCACCA
GAAACCCCAGGATGCACCTAACGTCCCCTTTTTCCTCTTGGAGATGCGCAAGCGCATTTTTGTCCGGTTTTACAGTACCG
ATATCACCATGGCCACATTTCTCGGCCGGCCACCCCGCATTAGCAAGCGCTTCTGCACGGTAGACCTGCCCTCAGACCTG
AACGAAACAGTCTTGTCATTGCGTGGGCCAGCTCTCGAGACCGAGCTGCAAAAACTTAATGCAGACGGGTGGAACACGAC
GGGGCAAATCCACTCCGGGACGGTGCAGCGGTGGGCCATGACGACCTCCATGATCCGGGAAGATGTTTTGGAGCTACTGC
TGGGCCACGGCAAGGCCGACGTGGTCCAAGTGACCAGGTGAGTATCGCTACGTAACTTGACGAGATGCGGAGACACTGAC
GACGGCAATTGCACAGCGCTTTGCGAGAAAGACTCATGGAAGCTTGGGCGTACTTGCCTAGTCGCATGGTCGTGTCGTCC
TTGAATGTCTGGAAAGAAAGAACAGACCGCGAAGAGGCCGAGTGTCTACACTTGATCCGGCTGTACTACCTCCACACGGC
CTTCCTGATTGAATGGGCTGCATGGAGCCAAGCCAGCCTGGAGCCAGACGATCTCTTCCGGTCTGCAACCGAGCTCCTGG
CTTGGGTCAACCAGGCCCTCGTGCGGCGTGAGAGCCTGCCCAAGCTTGGCTTCATTTCATTGGCATGGAGGGTGAGTTTC
TTTGTACTTCATTTCTCCCAGGTTGGCTCTGACTTGAATGCAGGTTGCAACATGTGCTCTGCCGGCAGCCGGCGCTATCA
GCCTGTGTCTGGTGCAGCCATCTTCGAGGACCTGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62