GenePrediction:GLEAN_879 Details

Name: GLEAN_879
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:555927..557907 (+ strand)
Length: 1981
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:555927..556028 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_132:556129..556154 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_132:556293..556628 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_132:556694..556727 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_132:556784..557041 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_132:557094..557373 (+ strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_132:557428..557543 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_132:557604..557746 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_132:557802..557907 (+ strand)
Length: 106
>GLEAN_879 class=GenePrediction position=GCSC_132:555927..557907 (+ strand)
ATGGATTCCAAGCTTGTCAACAAGTGGTGCCGTATGGTGTACGGAAAGGACCTGAAGGCTGGAAAGCTGGTCCTGAAGAT
CGACCTTCTTGTCATGACCTACGTGTGTTTGACGCAGTTTGTCAACCTGCTAGGCATGTGCAAATATGGAGTGCAGACAA
TTGGTCTTGTCTGAACTGTGGCTAACCTTGACCTGGTTACAGATCGGTCCAACTACTCCAATGCCTACGTGAGCGGAAGT
AAGCAACCCCAATCCGTCTCACTGCTCGTGTCTTGTTTATCTAACACTCGACAGTGTACGTTCTATCATATACTATACCT
CCAGTGGATCTGTGTTTAGTGCTCGGTGACCTAACCCCTTCAATAGGAAGAAGGATCTTCATTTCCATGGCAAGCAGTAC
AACATGGGAAACACAATTTTCCTAATTGGATACACCGTCGGCCAAATTCCCTCTAACATCGCACTCACGTACATCCGTCC
CCGGTATTGGTTCACTGCCATGCAGACCTGCTGGGCCGTCATCTGCCTTGCACAGTACTCTGCCAAGAACGTCAAGACCG
TTTTTGCTCTCCGCTTCCTGATGGGTCTTTTCGAGTCCAGCACTTTTGTCGGAACCCACGCTATCCTCGGTTCCTGGTAC
ACGCCCAAGGAGATCGGCAAGCGCTCGGCTATGTTTGTCAGTGCTGCCCAGGTCGGCTCAATGTGAGTTCTAACCCTTCT
GTCTATGTGCCTTTTTCACTATTGCTTTTCTAACGTATTAAAAACAGCCTGTCTGGTCTGATCCAAGGCGGTCTCTACAG
GGTTGGTCTACATATGAAAAATATCATAGCGATGAACCTAATTAATTCTCTCTACAGCACATGAACGGCAGAAACGGTCT
GAAGGGCTGGCAATGGCTTTTCATCATCGATTTCATTGTCAGCATGCCAAGCATCATCTATGGCTTCTTCTTCTTTCCTG
ATTTCCCGCACAACACGACCTGCTTCTGGTTCTCGGAGGAAGACAAGCAGCTTGCCAAGGCCCGCCTGCCAAATGCCCAG
GTCCATGAAGTTCAGTGGCGCAGCACGGCTACATGGAAGCGTATCGCCACAAGTTGGCACACCTATATGTTCCCCGTGTG
TCTTCCCAGGACGCAGTAAAAAAAAGCCAGTGCTGACGTTTCGCCAGATTCTCTTCACTCTCTATGGAACCGGTCTCCAA
ATTACCGGCAATAACGTCATGCCCTTCTTCATGGAGAAGCATGGCGATAAAAAGGTCGAGCATTTGAACTACTACCCAAC
CGGAATGACCGCAACGGGTATCCTCGCCTTCTGGGTGTACGCCATTATGTCGGATAAGCTTAGGACCCGTGTTCCTGCTT
CGATTGCCATTGGATGCACCTTCATCCTTGGAGCCGCACTGCTGTACTCAAAACACATTTCCTATGGCGGAAAGCTGACT
GCTTTCTGTGAGTTCCCCCGCAGGACCAAAAATAAATTAACAAGTCTAACCAGCTATTCAGATCTCCTGGGAACTTGCTT
GTCTCCTCAGGCATTGTGGTACTCGTGGGCCAATGATCTGACACGTGATCACTTTGAGCTCCGTATATTCCTCAACGGTT
CTATGAACACTATTATGGTAAGATGCCCCCCATCCGAAGCAGTTCTTGAGCTGGCTACTTACACAATGGTACTCTAGGAG
GCATTCATTGCTTGGTGGCCGCTAGTATTTTACCCAGCCGACTCCAAGAATTTCAACCGCGGCTTTATCTCCACCATGGT
CATCGGTGGGCTCATTATCATTGTCGTGCTGATCATCTGGATGCTAGAGCGGAGGCAGCTGTAAGTTTATCCCACTTCGG
CTTATCGTGACATTTGGTGCTAATATCTTTCACAGTGCACAGGAAGCGCTCGCTGAAAGGAACGTGCTTGAAGGATTTGG
CGGGAAATATGACGAGAAAGAGGCCGTCCGTGATGAGATCACACCTTCCAAGGAAGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62