GenePrediction:GLEAN_881 Details

Name: GLEAN_881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:566496..567912 (+ strand)
Length: 1417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:566496..566564 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_132:566768..567252 (+ strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_132:567342..567912 (+ strand)
Length: 571
>GLEAN_881 class=GenePrediction position=GCSC_132:566496..567912 (+ strand)
ATGGCGACCACGGAGCAACCCGGCCTGGGAGAGCCTCAGTTTGCCTCCCACGCATCAGCAGAGCCCGTCGTACGTGTCTG
CTCAAGCTGCTTTTTTGCGCCGTTCCCCTTCGTCCTTACCTCGTCCCTTCGCATGCTCCTTCTGACACGTGAAAGTACAT
TGGACTATGGAGTATTAACTTTATTTTTGTGACATAGGGCATCGTGTGTATCATGATAGCATCATGCTACTTTAACCGTC
GTCGAGACTATTCCGTTTTCCCCAACAAACAGAGCCAGGGCCTGCTAGGTCGGACAGATGTGGTCGATTTACGAGACGAG
CGCGACAAAGACGAGGATGAAGACCAGCTCGAGCTCTCCCCCGTCACCACGGCATCGACAAAGTATGGCCCGAAGAAGCG
AAATCTCTGTGGGGTTGTCGTGCAGACGCCGAACTCGTCACGGTACGCCAACTACTGGCACAGTCGATTCATTCAAAAGT
ACCCGTTCTTGGTCGAGATGTTCTATTGGGCCGTCAACCTCCTCCTCTACGTCTCTATAAAATCCGGCAGCGAGTACATC
TTCGCCACGGATGGTGTCTGGAAAACTGCGGAAAACCACGGCATCGCTGTACTCGATCTAGAGCAGAGGGGCATTTTCCG
CTTCCTGATTCCCATGCGCGAGATCGACGTCCAACACTTCTTCAGGGCCGGTCACCAAGGTGCTTTGACCGTTCTAAACC
GAGCATACTCTCTGATTCATATCCCGGTTACGGTTAGGTACGTTGAATTGCTTTTCTTGATCCTTCCTCTGGCTTCATAT
TCACTTGCCTGTGATCACATGGCTAATGCGAATCGGTCGTGCACAGTTTCCTTGGTTGGTACTACTACGCCGCGCCGTCT
CACGCCCAATTCGCATCTGTTCGCCGCATGATGAGCCTCACGAATTTTTTCAGCTTCGTAACTTTCATGACGTACCCATG
TATGCCGCCCCGTCTGCTGCCAGAGAAGTATGGATTTTTCGACACGGTTCGTCGTGAGGATGCCGAGTCCATCTGGGCCA
CGGGCAAATTTTTTAACCAGCTTGCCGCGTTTCCATCGCTGCATTTCGGTTACTCCTTCTGCATTGGCACGGTTTTGCTA
TACCATTCAGGCATCCTCCGCAACTGCCTGGCCCCACGGGAGAAACGCCAGTTCAGGCCACGCCAGATTCTCCTCGCCCT
CCTGAGCGTGGTGTATCCCGGCTTCGTCCTGCTCATCATCATAGCCACAGCTAATCACTACTGGCTCGATGCAATGGCGG
CGACGGGTGTTGTAGCTATGTCTTGGCTGTGCAATCGCGTCTTCCTGATGTTTCTGCCATTGGAGGATATCTTCCTCTGG
TGCGTCAAGTTGGAAAAGCCTATTCCCACTACGGGTTACAAAGGCAATGCATTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62