GenePrediction:GLEAN_883 Details

Name: GLEAN_883
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:576723..578008 (+ strand)
Length: 1286
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:576723..576779 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_132:576846..577246 (+ strand)
Length: 401
Type: CDS
Source: GLEAN
Position: GCSC_132:577307..577881 (+ strand)
Length: 575
Type: CDS
Source: GLEAN
Position: GCSC_132:577989..578008 (+ strand)
Length: 20
>GLEAN_883 class=GenePrediction position=GCSC_132:576723..578008 (+ strand)
ATGGATCCGCTAAGCCTGACTTGCTCAGTAGTAGCGCTGACACAAGCTGCCAGCTCTGTATGTCGATATGCCCCAATCCT
AATTTGAGCCACTCTTGTATACATCTCGTATTAACGACGACAGATTGCATCGTCGCTTTACACGGCTTTTGAAGCGCTGC
GCACCGCCGACGAGCGCATTGCATCATTCTGCGACGAAGTACAGAACCTTGCCGGGTTTCTTAACGCGATCAACAAGGCG
CTCACAGAATGTGGATCCATGGGCATGGCGACAGTGGGAGAAGACCTCTGGCGACAGAGCGAGCTAACGCTTAAGGACAT
TGGCACGACACTGCGCGAGATGGAACTTCTGGTAAACCAAATAAAGGAGAATAATACGGATGGTCGGCCTTATGGAATGT
CTCTGAAACGACGCGCACATATTGCCATCGACCTGAAAGCCCATGGGACAGCATTGTTGTCGTTCCGTGATAGGATACTG
AAGTCAAATTGGGCGCTCCAGACGATTCTAAACACCATCGCAGTGTACGTATGCCTGTTTGTTTGCTTGGGTCCCAGCCG
CACGACATTGCTGACCTCCTCCAGTTCTGTGTCTCTCCGAAATAGCGCTTCACAGGAATCGATCCTCATGGCCCTCAACA
AGCTGAAGAGATCAGTCGATGACGCTTTCCATGGTACACGACAGACTGACGTTTCAGCGCGAACGCGGACCCGCGATCGA
TTTGATGTGCAGATGGCCCAGAACCTGCACAAATTGGCCAAGGCTGCCCAGACGTTTCACACGACGGCAAGCGCCACGGC
ATCTACCATCCACGGCGGAAGTGCCCGTGTTGACCTATGGGACAGTCCTCTTGGTGCAACAGTCATGAGCATTGCGGGAG
ACCTCTCGCCTTTCCAGCGTGAGCGTATCGAGGGGTACATTGACGGACAGATGCAGCACTGCCTGGAGGAAGAGGCCTAT
TCCACATTGATCCCTGTGCTCCCCGAGAGCGAATTCGAAGCCGGAGACTACGAAAGATATACCAGCGTGTATAATTGTGA
CCAACAGGAACATGGATATAACATGATTGACGGAGACGACGATAGTGAGTTGGAAAAACTGTTCGTCGACAACTTGATGG
AGCTTGCCGAGAACCACATTCGCGACGGCAAATTCGCAAGTGCCAAAGAGTGTTTACATGAAGCACTACAGCAAAATTTC
GACGTTGTAAGCCACTTGAAGCTGCGACGGCTTCACGTTCTTTTGTCCTTCTGCGACATCATGCAGGGCGACTGGAAATT
GGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62