GenePrediction:GLEAN_886 Details

Name: GLEAN_886
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:591331..592733 (+ strand)
Length: 1403
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:591331..592419 (+ strand)
Length: 1089
Type: CDS
Source: GLEAN
Position: GCSC_132:592488..592733 (+ strand)
Length: 246
>GLEAN_886 class=GenePrediction position=GCSC_132:591331..592733 (+ strand)
ATGCCGAGTGCCATCACAGAGTGGCCTGCCTGGATCGAGCACACCAAGGCCGATCCGAAGCATGCACAGGATCCGGTGTA
CCTGTCGGCCAAGCGGGCCGTTTTGGCAGAGTACGGCGCCGAGGCGCTTCAGAAGAGCTGGCTGGCCGTGTGCGCACAGC
TCGAGGCCGTAACCGCGGACATTGCCGTCCGCGGCTCGTCAGCAATTCCCGTGCACGAGGCTGCCGACGTCGTCGGTCCT
GACGGTCTCTCGGCGGCTGCACAGGCCGAGATTAAGAAGCGCGGCTGCGTGGTGATCCGCCAGGTTCTGCCGCGTTCTGA
GGCCGAGCAGCTCTACGCCGACCTGCAGACATACGTGGCCGATAACCGGGACGTCATCCGTGGCTGGCCGGCTGACTCGC
CCTCGATGCTGATCCTCTACGACTCGCCGACCCAAAACGCCATCCGTGGCCACCCGAACCAGCTGCAAGTCCAGCGCCAG
CTCAACGGCTTCTGGCACGACGACAACAACACCGAAGCCGACCCCACGTCGTCTGAGCCGCTCATCTTCTTTGACGGCGT
CCGCGACCGGCCATCGCGCCAGGAGTTTATCGGTCTCGGCCCCCATATCGACGCCGGCAGCCTCAGCCGCTGGGCTGACC
CGGCCTACCGCCACTCCTACGCCAACGTCTTCAACGGCTCGCCTGAGCGCCACGACTGCTATGACCTAGGCGTCCGCAAG
CAGGCCCAACAGGCCCTGTTTCCCGCCACTGCCCACTCCACCGTCTTCCGCTCCTTCCAGGGATGGACTGCTCTTACGCC
CACAGGCCCGCGCGCAGGAACGATGCTGCTCTACCCCGACGTCCAGTCTGCTATCGCCTATGTCCTGCTGCGGCCCTTCT
TCCGCCCTCCAGCCGATCCCAGCCAGATCATGGACGCGTCCAAGTGGACCATCGTCGACCCCACCGACCAGGATGGTTGG
TTCCCTGGCACTAACAAGAACAACAGCCAGATGCTCAGCCGTTCCAGCCATCCCCATCTCCGTCTCGAGGACTGTCTCGT
CCACGTGCCGGCCCTCCAACCCGGCGATACAGTTTGGTGGCACACGGATGTCTGTTCTGCCCTTCCGCACCTCATCTGTC
CTCCTCACAATCCTTTGCTAACAACTTTTTCTCACAGGTTTGCCACGCTGTTGAGCCTGAGCACATTGGACCCACCAACG
CCTCCGTCGTGTACGTGCCCGCCTGCCCGACCACGGCCATCAATAAAGCGTACGTCAAGCGGCAGCTGGCAGCTACAACA
AACGGTCAAGTCCCTCCCGATTATATGCGTGGCAACGACCTCGACGAGACAAAGTTGAAAGGCTACGTTGGTCACGGTGG
CCTTAGTGAGGAGGCCAAGGCAGCATTTGGTTACTACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62