GenePrediction:GLEAN_888 Details

Name: GLEAN_888
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:627072..628063 (+ strand)
Length: 992
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:627072..627362 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_132:627436..627491 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_132:627562..628063 (+ strand)
Length: 502
>GLEAN_888 class=GenePrediction position=GCSC_132:627072..628063 (+ strand)
ATGTCTTCGCCGTCTACCCCTCTTTCGACCAGCGATCTGGAAAGCTGGGAGCCAAATGATGTCCAGAAGCTGCTCCACAC
GCTCATCCACAGACACTGTGTCTTCTCCGGCATGCACAACTGTGCCGCCGAGATGGAGAGAACGGTACAGATGCTCACCT
CCGAGCAGCTTGCCGAAATGGGTATCCCTGAAGAGCCGTCGGGCCAATTCCTTGTCCAGTGGTTCACCATCTATCGTGAG
CTATCTCGACTCAAGGGTACAGACACCACGCTGCAGGAGAAGCTGGTACAGGTACAAGTTCTTTTATTTCCTTTCTGTCT
GCTCCCGTCCGCCTGCCGTCATCTATTTCTGACATGTCCCAAAGACTGCCGACCGCATCCGTACTGAGGGTGAGGGAATG
CCAGCACCGCCTCCGCCAAGGTATGTTTGTATTTTCTGGTCCCTCGTCGTATCGTCCCTTACCAGACAGCCGTGGCTAAT
TCGGGCAAAGCGCCATGCCACCACGGCCTCAACAAGGACAGAAGCGCAAGGCACCGGTAGACGAAGAGCAGCCGCCAAAC
TTACAGCAACAGCTGCAAGAACAGGCCACAAAGGCTCAACCGCTGCGGCAACAGCCACCTCCGCAGATGCAGATACAGAC
GCAGCCGCAGACGCAAACACAGCCAGAAGTGATATTTGTGCAGGAGAAAAAGGTGTCGCCGCCAGAGCAGTCGTTGCCAT
CAGACCAAATCATCACCAGGCCGCCGCGATCAACTTTGGGACCACAACCGGCATCACTGCACCCAAATCGACACGGCAAG
AAGTCGTGGGAAGAAATTCTGCCCAAAACGGAAGACGGCAACTGGGACACGCGCAAGATCGACAACGACGTCATCCGCAG
CATCGACGACTACCAGCTGCGCCTTATGATCCTCGAGCAGCGAAACAGACAACTGCTGCGAGATGCCCGAGAAAAGGACA
ACAGCGCCCCGTCAAATGGCCGCCATACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62