GenePrediction:GLEAN_889 Details

Name: GLEAN_889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:628818..630651 (+ strand)
Length: 1834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:628818..628851 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_132:628922..630651 (+ strand)
Length: 1730
>GLEAN_889 class=GenePrediction position=GCSC_132:628818..630651 (+ strand)
ATGGCCGACATGGATGTGGACAACACAGTCCCAGGTAACACTTCTATTATACCAGGACTCCGTCCCTGTCTTTCGGGTTT
AGCTTGTTTGCTGACCGATGCCAGTCGTCATCAAGCACCAGGGCAAATCATACAACATCGACGTCGACACCTCCGAGCCG
GGCTCTGTCTTTAAATACCAGGTCTACAGCCTGACCAGCGTGCAGCCAGAGAACCAGAAGATCCTCTGCAAAGCCAGCCA
GATCAAGGATGACACGGACATGTCGAAGCTGCGCCTGAAGGCAGGCCAGGTCATCATGGTGCTGGGACAACCGGGTGAAG
CACCAGCGCGGTTCGAGGCGCCCAAGGAGAAGACCCGCTTCGTCGAGGACATGAGCGCCCGAGAGCTAGCACAGAAGGGC
GGACTCGCCGTCCCTGTCGGCCTCGAGAACCTTGGAAACACGTGCTACTTGAACTCGTCTTTGCAGGTCATGCGGTCCAT
CCCAGAACTGCAGGACAACCTGGTCAACCACTTCAAGCCCAGTGAGGACCGGTCCGTCTCAAACCTGACCAGCACGCTCC
GCGACGTCTTCTTGGACATGTCCACGACAGGCGATACCGTCCGACCTGAGGGCCTCCTCAGCATGCTGCGCAAGTGCAAC
GAGCGATTTGCTGAGCGAACCCGCACGGGTGCATATGCACAGCAGGATGCCGAGGAGGCCTGGACCTATCTCATCAACAA
CCTCAAGACGACGCTGCCCCTCGAGGATGAGACGCCCGCGGCTGCAGAGGGTAGTGCTGGAAGCAGCACCAATGAGAACG
GTTCCAGTGCCAGCAAAAGCAAAGGAAAATCAAGCGTCATCGACCGTTACATGACTGGCCAGCTGGAGAGCGTGACCGTC
TGCGACGAGGCCGAAGGAAACACAGAGGACAACGTCAAGCCGGAGAGCAAGGCTTTTCGTGTCCTGGACTGCCACATCAA
CGAGTCGGTCAATCATCTGCGCGATGGTCTGCTGGCCGGCCTAGTGCACAAGATGGAGAAGTCGTCTGACGTGCTGGGCC
GGACCGCCGGCTTCACATCGACCGACCGCATCTCACAACTGCCCAAGTACCTCGGTGTGCACGTGCTGCGCTTCTCGTGG
AAGCGGACTGCCCAGCTCAGCACCAAAATTTTGCGCAAGGTCACTTTCCCGCTGGACCTCGACATCACCGAGTTCTGCAC
TGACGAGTTGCGCCTCCGGCTGGCCCCCATTCGCGACAAGGTCCGCGAGGTGGCCAAGGACGTCGAGGAGATCGAGCGCA
GCAAGAAGAAGCGCAAGCGCCGCATTTCGGAGAGCAAGCAGTCGGGTGAGCCCGCATCATCGAGCAGCAGCAGTGCCGCC
GGCAACAGCAGTGGCAACACCAGCAGCAAAACAAGCGGCAAGAAAGAAGAGCCCGTCGAGAATTTCAAGACCGACGCCGA
GATCGAGGCAGAGAAGCAGGCCGTGGTTGAGAAGGCCAAGGAGGAGCTCTACCAGCTGGTCAAGCCGCACCTAGAGCAAG
ACCGGTATGCCAACCACAGCGGCCTCTACCAGTTGCGGGCCGTCCTCACCCACCAGGGCGCCCGCTCTGACAGCGGCCAC
TACACGGCCTTCGTCAAGAAGGGCACCATCCTGAACCCTGTCTCTGGCCGCATGTCCGAGGAGGACGGCAACTGGCTCTG
GTTCAACGACGAGACCGTCACAGAGGTGGCTGCTGACCGCATCGAGAGCCTAGCTGGCGGCGGGCCGTCCCATTCTGCTT
TTATGCTGCTCTATGCATCCGTGCCGCTGCTGCTGCCGGAGAACCGCGTGACAGAAAAATTCTCGCAATCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62