GenePrediction:GLEAN_88 Details

Name: GLEAN_88
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:572505..579690 (+ strand)
Length: 7186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:572505..572571 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_179:572687..573728 (+ strand)
Length: 1042
Type: CDS
Source: GLEAN
Position: GCSC_179:573903..576443 (+ strand)
Length: 2541
Type: CDS
Source: GLEAN
Position: GCSC_179:577086..579690 (+ strand)
Length: 2605
>GLEAN_88 class=GenePrediction position=GCSC_179:572505..579690 (+ strand)
ATGGCTAAAGGACTCGATGATCTGATCAACTGGCTCGTGGAAGAGACGGCGTATGCTGGAGAAAAGGGTGCGTTTGCTCC
CTGCTGTTCCCGCCCGGATTGCGCTGTTGTTTTGCGCTCATCGTTGGCAAGGCTGAGATGTGAGATTGTGCTGACGAGCT
CTGGCAAACGCCTCAAAAACAGGCCAGTCAGTAGCAGAATTTGTGGCGGCTGTGAGCAGATTCAGCTCGCGGCAGCAGAG
AAGGAGGGCGAGGCATGGCGACCGCCATGGCGAGAAGATGGGCGCGGCGGCCGCAGCAGCTTACGCCGATGGGCTGAGCT
CTGGCGAGACGGACATGCAGCTCGCACGCAAGGCGTGGGAGTGGCTGATGGAGCGGCCAGAGATCCTGGTGGGCCGTGGC
GAGCCGGGCAGCAAGGGCCTGTCGCTGGACGATGTGCTGGCGCTGCCGGAGCCGGTTGAGCCTCCTTTACCTGTTGAGGC
AGCCGACAAGGGCAAAGACAAGAAGAAGGCCCCAGCCAAGGGGAGTGCTGCCAGCAAGAGAGCGTCGACAGCAGCAACAC
CACCGACATCACAGCTGGCCGACGAGCAGGCGGGCACGCGGCCGCGGCTCTACGCGACAGAACAGACGATCTGGTACACG
GTTACGGGCCACGACGTCGACTACAAGAAGATCCCGCCACTGGAGTGGAAGTGTCTCATGGGCATCGCATCGGCCAAGGA
GCACGGCATCCTGCAGGGTGATCTGCGCGCGCTCGTCAACCAGGACAAGCGGTCGGTGCCGAAGCGGACCGATTTTCTAG
CTACTAAGGGCTATGCCATCAAGCGGACGACGATTGCGCGCGGCTACCGCACGAGCATGCTGTGGCTGACCGAGTTTGCG
CCAGTGGAGCTGCCCGAGGCCGAAGACCCATCGATGACAACGTCGGGCGGCATCGACTTCTCGGCGGCCTTTCTGACCAA
GGACCTAGAGCCGGTTCCGTGGCGAAACCGCTGGACGGGCGAGTCGATTGAGTTTGCGTCGTTTGGCCAGACGATCCTGG
CCGTGACCAAGGCCTGGGGTGTCATCCGGCTGGTCGACCTCAAGCAGAAGCTGGGCATCCACAGCCGGCCGTGGCACATG
CGCACGCTCGCCCGATCCTGCCGCGAGTTTGTGGCGTCGGGTGTGCTGCGCTACGTGGCGGCTGTGCGTCAGGACGAGCG
TCGTCTCTTCAAGGACTGCATCAAGTACGAGCGCGACCCGACCAAGGAGGAATGGGCCATCTACCTGGCGGCCGGCCGAA
AGCGGATCCCGATGACGGAACTGCGAGCCAAGCAGAAGCGACAGCTGCTCCGAGGCACGGGTGGCGACGACGACGACATG
GTCGACGATGAAGATGACGAGGACGGCGGTGGTGGTAGCGGTGTCGTTGGCATCGGCTCGGCCCTGCTGCCATCGTGGGT
GCCGGAGAAGCCGCTGGCCAACCTGATCTACGACACCGTCCGACAGGCTGGTCCACGCGGCATGACGTCGCCGGATATCT
GCAAGGCGACCGTGGGCGCCTCGTTTGGCCGCTACATGTTCTCGCTCATGGCCGATCTGGCAAAGTTGGGCAACCAGCCG
GAGCATCTGGGCCGCTTCCAGCTGCGCAGCGCGCCGGTCAGGACGGGCAAGAACAACGCGTACGTGTTCGTCGCCAGCGG
CATGGAGGAAGAAGAGGCGCAGAGGAGCAGCACGGCGAGCCAGCTGGTGTCTGAGCGATCTGACGCCGACCCGGTGGCCG
ATCTGAGCCGTCGCTTCGGCTTCGTCACACGACCCGACACCACGGCCAGACAGGCCGAAGGACGGACTCTGTCAGAACTT
GCCGGCAGCGTCTCCACGCAAGGCGGCTCTCAACGGCGCCATTATCACCATCGTACCATTGGCCGGAGACAGCCGATGGC
AGGGAAGGCGGCGCAGCGGAAGAGACAGCCACATGAAGGGGACGAGACCGAGGCCGTCAACAGCAGCAGCGCCAACCCAC
CGCGGAAACGAGGACGACCGAGGAAGATACCGGCGCCCAGCGAAGTCGAAGCACCAGCACCGCAGCCAGACGAGCCAGAT
GAGCCAGATGAGCCGTATGTCCTGGTAGGCAAGCCAGGATCGCTGAACCAAGGACTGAGAGTAGACGGCCGTCCAAAGCG
GTCCATTGTGCTCGTGGCCAAGCTCGACAAGCTCAAGGACGGCGGTTTTCTCGAGGGCGGCGGGGGCTATAAGGCGGCCG
AGAGCCTGTCGCAAGAGGCTGCGCCGGCAGCTGTGCGGAGAGACTGGCGGGCCGTCCTGGAGCTGGGTGACTCTGTTGTC
CCTGAACAGCCTCGGCGCGAGGAGACACCGGCAGCCAAAGTCGACGCCGTCGCGGAGGTGTCAGCGCCAGGGGCTGTGGT
ATCACACTACAACGGATCGCCCGGCCGTCTGACGGTCGACACGAGCAGCCTGAGGCTTCTCTTCAGCTTTGACAGAAACA
CGGCGTCCAAGGCGTCCGATAAAGCGCCGCTCACAATAGCCGTGGGCAGTATCGTCGGTGATCCCAGCATCCGGGATGCT
CCCGGAGGTGCCGGCGAGGCTCTGGTGCTGCAGGCCCGAGAAGGAGACGGCCGGCAGGAGTCGGAGCCAGTCTGGCCGTT
TGTCTTTATCCTCGACGGCGCCGACGGCAACCACAAAAAGGCCATGGCGCTTTGTAGTCGTTTGACGGAGCTGCGTAAGG
CAGCTGAAGACGACAAGGACGATGACGAGACCGAAGACGGTGACGTTGGCGATGATGCTGCAATTGCTGGCACAGCTGCT
TCCGGCCGAAGGCAAGGCCGCGGGCTGAAGAAGGGCAAGCCGACGTCGGGGCCGAAAGAGTACAGCTGCGAGAAATGCGG
CGGCACGTGGAAGAATCTGCTGGGGCTGCAATACCACCAGACCAAGGCACGGACGTCGTGCAATCCCAACTATGCGCCGC
CGCCGATCATGGAGATCAAGAGGAAGACTCGGGAGCGGAGGGACAAGACGCACGACCGGGAAGGCGATGGGTCCAGCTTG
TTGTCGTCGCCATCCGCAGGCCGTGTCAGAGGCGAGTCCATGGGACCGGCACGCAGACTGTTTGGCGGCAGCTCGAGGGC
TGTGGCGCCGCGAGGAATCGTTCGCAACCCAGCACTGGCAGTCGACAGACGAACGGAGCCAGCGAGCAGCGAGAAGGACA
ATCGACCTCCCCAAGGGGAGAACGGACAGACGGACGCAACTGCAGCAGCAGCAACAGCGGCAACAGCAGCCTTTATACGA
AGAAGAGAGCTGGAGAGCAGCAGTCTCGAAGGCGAAGTGGCCAACATTGACCCACGACTCAGGACGCCACAAGTGCCCAA
GGCGTCGATGCTGCCGACGGGCAGCGTGCAGTTTCCACTGGCGGCCGCAACAGCAGCAGCAGCAGCAGCAGCTAGGAGCA
GCACGCCCGCCAGCAAGACAGCTAGCAAGACGGAGAGGTTGGACGGCAGCAGCGCAGCCGCGCTGACCGGCTTCCAGATG
CCTTTAGTGCGGGTGACGACACGGATGACGTCGTTTATGCTGCGGTCGACGCGGGTGGCGGAGATTGTCAAGCACCTGCT
GCGGTCATCCGGCGGGGTGTTTCCGAGCGACCGGTCGCTGTGGTACGCCGTGTTCGGGGTGTACACGAAGAGCTTTCCGG
GCGAAGACCCGCCGACGCTCAACGTCAGCCGGGCGGTGATGAAGAAGCTGGAGGCGGCCAAGGCGGTGGAGGAGCACACG
TTTGGCTTCCGCGACGCCAAGGGCCACTTTATCTACCTCCGACTGCTGGTCAGCAGTGGCGAAGACCCAAAGTCGGACGC
GGCACGAGCGATGCGCCAGCGAATGCAGGAGAGCCACCCACAGCCGTATGTGCCGGCCGAGTTTGCGCCGTCGGACAAGG
ACATGGCAGTGCTGCGAGTGTACGACAAGGAGGCGGCAGCCAAGGCAGCAGCAGCAGCAGCGGCAGCCGAAGGAGCGGAT
GTGGTTGAGGGAGGGGGAGGGATGGGGGGGTCGAAGCAGACACAACGTGGCCGACGATCGTTGGCATCGGAGATCGAGGT
GCTCAACGCCCCGTTCTACGAGCATGCCGCGACTGCGCAGCCATACCGACCAGGACGCAACGGAGCCTATATTGTCAACT
ATGGCGGGGGTGGTGAGGATGATGAGGGCGTCACGGCGACAGCGACAGGAGCGAGCGGAAAGGGAGGCAGCAGCGGCGGT
GGCGGAAGCAAGCGTAAGGCCATCGGTAAGGACGTTGGCAGCAGTGCGAAGAAGCGGCGAAAGACGGCCCGGTTTGCCGA
CTACATCACGGGAAAGGCGGAAGAGGACGACTGGCGAGAAAGAGAGGGAGAGAGAGGAGAGGGAGGAGAGGGAGAAGAGG
GAGGAGAGATGGAGAGAGAGATGGAGACGGAGAGGGCAAGACGAAAGAGGAGAGGTCAGCTGACGGGTGAAGAGGACGGC
GAAGACGTGGAAGAGGATGAGGTTGAGGATGAGGAAGTTGAGGATGAGGATGAGGAGAACGACGATGAAGACGAGGACGA
TGAGGACGTGGATATGGACAGAGGCCAAGACAAGAACGACAGAGATGGACGACGTCTGCCGACATCCGTGTTCGACGGGC
TGACATCGATCCGCTTTCTGGTGCCGAACACACGGTTGGGAGACGAGGTGGACGAGATGGAGGAGGGAGTGAAGGGAGTG
GAAGACAGCATGGACTACAATGTGGTCGACAGCCAGATTAGTCACCGTGTCCGCTTGAGTCACGTGACATTCACCAATCT
GGTGGTGTTGCGAGCGACAGTGGCGTCGCGGGACGTATGGCCGGCACTATCGGATGGTTTTTTTGAGAAGCAGGCGGATA
GCCAGGGGGTCAGCTTCACGATGAACGGCTGGCTGCCGGGTCGGACGGAGCGGTTGCGGGACAGCCTGCCGCAGACGGTG
GCCGAGTGTGAGCAGCAGCTGCGCGGCAGTGTGCGGATCGGCAGGACTGTCAGCACGGCGGCCGGCCGCTTCTTCCGGGA
CGTCGAGCGCTGCCGTCTGTGGGAGATGTCGCCGCGCGGTCACCAGCTGCTAGCCAGCGGCGCCACGGTCGCGCCCGAGC
ACGTCTTTCTGCACGTCGGTTTTGGCGGGGAGCATCGGCTGGCGACGGGCAGCGCGTGTCCGGTGCTGCGATGGAGCGAG
CGGAACCAGTTCGGGCTGGCATCGGTCCCGTCCGGCACGCCGGAGGAGGGCGAGCGAGGAGCCGGTAGTGCGGGATGGAG
CGGACGAGGCGGAGCGAGTGGATGGGGTAGAGGAGGCGGATGGGGACGAGGCTGGACGGCCGGCGGACGGGCTGCTCAAC
TGCGACAGGCAACGTACCTGGCGAGCTCCCGACGAGAGCTGACCGGCTATCCACAGACAGAGAGAGACTATCTGAGGGGG
AGGGCCACAACCACTCTCGACTGGTCCGCCGACGAGACGCTCATCGCGGCATTTGTGGCGATCAAGACGCTCATTGGCGG
ACTCAGCCAGGCAGTGGACTGGGGCCTACTGATGCGGCTCTTCCCCGAGCGGAAGCTGTCAGGCCTGCGGGCGTTTTGGA
GCACAGCCCGTCGCGAGCGGGCAGCCGTGGTCGATGGCCTGGCCGAGCGGTTTCAGCAGGCGTTTCCCGAGGCGTACGGT
CGCGGCGAGCTGGCAGCCGTGCTCGACTACAACAATGTGCTGGCATACGACTGGGCCGGCCTGGTGGCGTGGACGCTGCG
ACTGATGCGGCGAGGTGAGGCAGACGCGCTGCCGGCAACACGCGAGCAGCTGGAGGGAGAGTATGTCGTGGGGGGAGGAC
AACCACAACCGCTCTCTTCCTGGCGAGAAGACTACTACCATCCGACACGCTCGGTGTGGAACCGACTGCAGGACGCGGCT
GGCGAGGCGGCCGTGCTATCGCTAGACGGGCCCGGATTGTCAACGCCGGCCGAGGCCGCAGCAGCGATGGAGGCAGCACG
AGCAGGCGGCAAGGCAGAACAGGCAGCAGCGGCACGATCTGCGCTGCGACACTTGGTGGCTCGGTCATGGCTGCGGGCGC
TGTGCGCGACGCCACACGAACGGTACCGGCCATCGCGGATCAAGCAGAAGCTGTTGACGCTGGGAGCGGTGGGCGGGGAC
GAGCGGCAGCACAGCGAGAGTCCCGACACGATCAACCGGCAGCTGCAGGCAGTCATCGGCGAGCTGCAGAACGAGCGGGT
GCTGCGGCGGACCAAGTCGATGGTGGCGCTGGGTGGCCGCATGTATCTGCTGGCGGAGGCGTACGCGAGCACGCTGGACA
AGGCAGCACAGCAGGACAAGTTCCGGCAGGCAGCCGCGTTCAAGCGGCGGCTCGACCACAGTTTCCGGGCCGACCAGACC
GTCGAGCTGTCGCCGTCGACCAACGACGACGGCATGGTGATGGCGCTGCTGAACCTGCAGGCCCACGGCCGCGTGGCCGT
CGAGGCGGTCGATGCGCCGTGTGTGCCGTTTGGCTTTGAGCCGGGCAATTACGAGACGCGCAAGTTTCCGAAGCACTACC
AGCGATTCCGCCAGCGGGTGGTGCCGACCGAGCGATACGTGTATGGGGAGGACGAGGGCGAGGACGAGGACGGAGAGCGG
CTGTCTCTGATGGATGCACCCGCACCCGGACCTCACGGCGAGCTGCCAATGTGGCGCGACTTCTTTGGCGTGCTGGACCG
GAGCCGATTCGTCCGTCTGGCCAGTGCGGTGGTCTTCTCGATGGCGACACGCGGCGGCGCCGTGGAGCCGCGGCAGACGG
CAGCCCATCTGCGGCCGGTGCTGGAGCCGTTTGAGGTGCAGATGCTGATCGACTGGGCGGTGGCGGTGGGGATCCTCGAG
AGGGGAGGCGGCGACGAATGCACAGTCTGGCACCTATCGGAATGGTGGTGGCTGCTGATCGGACGGATGTACGAGGGGCT
GGACGGCGAGGAGACGACGGCCAGCGGAGAGAAGGGCGAACACGGCGAGGACGGCCGTGGCGAAGACGAGGACGAGGACG
AGGACGAGATGGAAGTCGAGGTCGAGAACGAGAAGGAGAAGGAGAACGAAGACGAAGACGAAGATGACGGCGACGAGGGG
CCTCTTGCCGACGTCGGCCGCTCCAGCAGAACCGACAGCTGGCGCGTTATCTGCGGGCTGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62