GenePrediction:GLEAN_890 Details

Name: GLEAN_890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:670483..671261 (+ strand)
Length: 779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:670483..670485 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_132:670610..671062 (+ strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_132:671138..671182 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_132:671253..671261 (+ strand)
Length: 9
>GLEAN_890 class=GenePrediction position=GCSC_132:670483..671261 (+ strand)
ATGGTACGTTGCTCCTGGGAGATGGATGACGAGACGGCCAAGCAGATGGTGGCTGGACACGCGTGCCTTCCTTCTGTTGC
TATTGTTGTGCCTGCTGCCGCTGCTGACACTTCCGCCTCCCCCGCAGTCACAATCCCTGCGGCCGTACCTGCAGGCGGTG
CGCAGCACCCTGACGGTGGCCATGTGCCTGGTCAACTTTGCGTCGCAGGTGGCGGAGCGGCACAACGTACCTGAGATAGA
GGCGCGGTCGTCACCGGAGCTGCTGCTGGCGCCGCTGACGGTGGCACGCAACGAGCACGAGCGGGTGCTGATCGAGGCCA
GCGTCAACAGCGTGCGGGTCAGCCTGAAGATCAAGCAGTCGGACGAGATCGAGCACATCCTGGTGCACAAGTTCACCCGC
TTCCTGACGCAGCGTGCCGAGTCCTTCTTCATCCTGCGGCGCAAGCCCGTCGACGGCTACGACATCTCCTTCCTCGTCAC
CAATTTCCACACCGAGGAGCTGTTGAAGCACAAGCTGGTCGACTTTGTCATCGAGTTCATGGAGGAGGTCGACAAGGAAA
TCTCCGAGATGAAACTGTTTGTACGTCCTCTGCCCTCTCCCCCTCTTTCGGCATGTCCCGCCGTCCCCGACTGCTGGACC
ACGACTGACCGATAGCTTAACGCACGCGCCCGTTTCGTGGCCGAGTCCTTCCTCACGCCGGTACGTGCTCACCGCCAGCT
CCGTCTGGACGCCCTATCCTTGACCCACATACTGACTTTACGGTTTCTAGTTCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62