GenePrediction:GLEAN_892 Details

Name: GLEAN_892
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:698211..699254 (+ strand)
Length: 1044
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:698211..698431 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_132:698519..698870 (+ strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_132:698925..699254 (+ strand)
Length: 330
>GLEAN_892 class=GenePrediction position=GCSC_132:698211..699254 (+ strand)
ATGAATCTCGAGAAACACTTGCCACAAAAGTGGCGTCACTCCAAATGGCTCTGGATCCTTTTGGCCATCATTGCCATTAT
CATCATCATTGTCATCGTCGTCCCTCTGGCCGTCCTCCTTCCGCGGAACAATCGCCACCACAAGCACCTCAGCACATCCG
TCCTGCTGCCGCTCTACATCTACCCGACCAACTCGTCGACGTGGTCTCCTCTATATGAAGCGTGAGTATTCGGTCAAAGA
CTCCTTTCTCTGCCCTATTGCCCTATGCTATAAACACGCCGCTCATACTCCCCCTCCCTTCCCCACAGCTTGACTAATAA
TCCCGTTCTCAACTTCACCATCGTCATTAACCCCAAGAGCGGTCCCGGCTCTGGAAACATTCCCGATGACAACTATGTGG
CCGGCGTGAAGCGTCTCAACTCGTTTGCCAACGTCCGCACCGTCGGCTACGTCCGCACCGGCTATGCCAGCCGCAACATC
TCAGACGTCGTCGACGAGGTCAACATCTACTCCGGTTGGTATACCAACAACAGCGACATCGCCATGCACGGCATCTTCTT
CGACGAGGCGCCGCACCAGTACACCGCCGACGCGGTTGACTTCATGGTCACGGCCGACGCCGCGGTCAAAAACGCCACCG
GCCTGCGGGGCTCCAAGACGGTAATACTTGTCGCTTCGTCTAGCTCCTCTCTTGCTGATCACCTTCCTGTATAGATCATC
CACAACCCTGGCACTGTTCCCGATGCGGAATTCAATGTTACCAGCCCTGACATTACTGTCATTTTCGAGGACGACTTCAG
CGCTTGGAGCGTGAAAGAAACCACGGTCAAAGCCTTGTATGAGACATATTCCACTCGGTCGGCGTACAGCATCATGGTCA
ATAGTTTACCCGTTATGGGTAACAACACGCTCAGCGGTCTTCTAAGCACTCTCTCCCGGTTTGCTGAGCATTTATTCGTC
ACCGACCTAACGGCCGACTACTACGAGGCCTTCTCGGATGACTGGCTCCAATTCACCGAACAGATGCCTCTTGGCACCAA
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62