GenePrediction:GLEAN_894 Details

Name: GLEAN_894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:712326..714068 (+ strand)
Length: 1743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:712326..712598 (+ strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_132:713022..713210 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_132:713685..714068 (+ strand)
Length: 384
>GLEAN_894 class=GenePrediction position=GCSC_132:712326..714068 (+ strand)
ATGAAGAACGCCGCTCTGCTGGTGCTCTTCACAGCAACTGCCGTGCGTGCTCAGGCCGCTGCCTGTCCACCGTGCGCCGC
CCAGATTGCCCTGGTGCCTGTGTGTGCCACTGACTGCATCGAATCTGCAGCCGTCACCAACGTCGGCTGCGTCAACGGGG
ACTACGCCTGCCAGTGCGCCTCCTCCTCTGCCATCCAGAACGCCGCGCTCAACTGTGTCGTCAGTGGCTGTGGCATCGCT
ACCGGTCTGGCCGTTATCAGCTCCGTGTCAAACGTGTGCACCTGCGTCTCGTCGAACGGCTGCTCTGTTAGTAGCAGCAG
CAGCAGCAGCAGAAGCTCTGTCACGACTTTGACTTCGACTTCCTCGGTGCTTCTGACCACCTCCTCGAGCTCGTCTTCTT
CGTCGACACCGGCATCCCCGTCGTCGACGCCATCGTCTCCGGCTTCCTCCACGTCCCCGCCCTCTACATCTTCGTCGTCT
ACATCTTCTTCGACCTCGACTTCTTCTTCCTCTTCTTCTTCCTCCTCCTCTTCTTCTTCCTCTTCTTCAACTTCTTCATC
GTCCACTTCATCCACTTTATCTACGCTCACGCCTTATTCCACGCCGTCTTCCTCGCCCTCTTCTACGTCTTCGTCGTCGA
TAACCCTATATCTCACAACCACACAACCATCTTTCTGTACGCCTTGTGCTCCACAGATTTCTGCCGTACCTGCGTGTGCC
ACCGGCTGTATATCGTCTGCCGCCGTCACCAATGTTGGATGTGTTGATGGCGACTATGCTTGTCAGTGTGTCTCTTCGTC
CGCCATCCAAAACGCCGCTCTGAACTGTGTGGTTAGCGGCTGCGGCATCGCCACCGGAATGGCCGTCATCAACTCTGTCT
CCAACGTGTGTACATGCGTGACTACCAGCGGATGCGGAGGTGCCTCGTCATCGCAGCCTTCGTCATTGTCCTCAAGCACA
ACCTTGACTTATCCATCGTCTCCGCCCCCGACGTCTATACTACCGTCGTCTTCTATCTCGTCGTCCTATCTTACTTCGTC
CTCTTCATCTTCATCTTCTTCGTCTTCTTCTGTCCCATCATCCATCCTCTCATCCATGTCCTCAACACGGACCCTCGTCC
TCCCTCCCAATCTCTTCACCTGTAACTACTCCCCCTCCGGTCTGCTCTCCCTGTGCATCCCAATTCTCCGCGGTACCAGC
ATGTGCCAGCAGCTGCATCGAATCCGCAGCTGTCACTAATGCCGGTTGTGTTGAAGGCGATTATGTGTGTCAGTGCGCAT
CAGCTTCGGCCATCCAGAACGCCGCTGTGAACTGCGTCGTAGGTGACTGTGGTATCGCCACCGGCCTTGCCGTCTTAAGC
TCGGTCTCAGATGTCTGTACTTGTGTGACGACAAGCGGCTGTGGTGCTTCCACTTCAACTCCATCCACCGCTCCTCCGGC
ATCCTCTTCTCAGCCTCCAGTATCTTCTTCAGCTACACCCTATTCTACATGGACCTCCAGCTCATCTCCACCCTCTTCTA
TCCCTCATTCCATCCCTTCTTCTCCCTCGGCTACCCACTCATCTGTTATTACCACTCCCTCTTCGACAACTCCGTCAACT
ACCACGCCGCTGCCTTCCTCGTCTTCACCAGTGACAACACCACCTCCGGTGTGCTCACCTTGCGCAGCGCAAATCAGTGC
CGTCCCGTCCTGTGCCAGCAGCTGTATCGAGTCTGCCGCCGTAACCAATGCTGGCTGCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62