GenePrediction:GLEAN_895 Details

Name: GLEAN_895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:720818..724946 (+ strand)
Length: 4129
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:720818..721127 (+ strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_132:721205..721842 (+ strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_132:721919..722061 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_132:722472..722553 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_132:722617..722874 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_132:722928..723023 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_132:723081..723135 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_132:723180..723252 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_132:723311..724946 (+ strand)
Length: 1636
>GLEAN_895 class=GenePrediction position=GCSC_132:720818..724946 (+ strand)
ATGGAAATCCCCCCCAACTACTGTGACGACCCGCGCTTTAGCAGGACCTTTGTGCTGCCACCGAACCCAGCCAACGGTCG
ACCCAACCCATTCACAGTCAAGTATGCTGACTACGGCTATCGCAATGAGGCCCATCCCGAAGAGGGGATTGTCCTGCTCG
TCTTCGGATCTATGCTGGCGTCCCGCCTGGTACACATCCCCAAGGACGAGGTTGCCAAGAAGCACAAGGTCCGCGTCATC
AATCCGGACAGGCCAGGCATAGGGGGCACCGATGCTGTTGCCGTGGACGACATGCTTCCTCGGTGGTCGGGTGAGTGTCT
CGTCTCGAAACGGTCTTGTCATCCGGCCATCCAACGTGCGGGGAGACTGACTCATCGTGCCGAACAGAGACGATGGCCGC
TCTGCTAGTGCACCTTGGCATAAAGCACGTGGCCTTGAGCTGCCACAGCGGCGGCACACTTTTTGCTCTAGATCTACTGC
TGCGCCACCCAGAGATTCTGAGCCCGGACAGGCCGTATCTGGCGATCGGCGCGCCGTGGATCAGACCTGCCCACACGACG
TCGACGCTCATGTCCGTCGTCCAGGTCCTTCCTGGGGCCGTCGTCGGCAAGCTGAACAAATTTGCCCGTTTTTTTAACCA
GCACCTCAGTCCGGTCCTGGGCGCTGCGGTTGGTGCCAGCCAGGCTTTCGTGTCCACGGTGACGTCCGCAGCCTCGAGCG
GTAGCACTAGCGATGCGGCTGGCGATATGGAACGTGAGGGTGCCAGATTTGAAGTCGACGTGTGGCCGACGCTGCTGAAG
CGCATCTACGTTGAAGGCATTGAGGGCATCTCATCGGAGGCGCTGCTGTTCACGCGTAAGAGCGACGGCGGTGCAGCTTC
TGGTTGGAGTGACTGGGGGGACTACGACGTGCTGGTCCCACGCCTGGTCACCGCTCTGCGCAGCGCAGGCAGACGTCTTG
TCGTCGATGTATTCTACGCCGAGACAGACTACATGATTGGGGATGGAGGTACCAAGGGTCCGCTGGTAAGATGCCTCCCT
CTTCAGACCGCGCCTGGATTTTGTCAGCAAGGAAAGGCATTCTGCTGACGCTCTCGAGCAGTGGTTTGACCAGTGCTGGG
ACGCAGAACATCGCGGCGACGTTGTCGACTATAGCTCCACTGTTATCAAGGGTGCCGATCACGATCGGATTTGGGATCTC
AGATGGGGTGTTGCGCAGCAAGTGTTTGAGACAATTGGCCAAACGTAGGTCACCGGTTGCACATATCAAATCCGCAATAT
ACCCGTAGTTGTTTCCGTTTATGTAGATAGCCGCACCAACAAATGTATAAGTACCGATTCATGCAAAGTGTGGGAAGCCT
ATGGGATTGGGAGCCTAGCTGCGCAAATATTGCAAGATACCACCCCTTGGACTCCGATTGTTTCAGTTCGTTTGCCGCTA
ATGCAACCGCCAGCCACAAAGGTCGAATAGATAGGCCGAACAGCTGCGCGTACGCCGTCTTTTTTGGCGTATAAATACTC
GCATTTGCCTCTGTGTGTTTGTTACTCCGAACTCTGCTTCTTTCCATCATGACGCGAAAGATTGAAGAAGCGAAAGCAAA
TCAATTCAGCCAAGATAAACAAGCTCCCCCGAAAATGACCTCTTCAGACGTCAGAGGTCTCGGGAACGAGGGTATTCTGA
AGAAAATTGACAGTCTTCGAGCGGCCAATGTGGGCACGCTCATACCTCTTCCTCAGGTGAGTTTCCACTTGACTCTCTAA
TGGTCTGGCTCTTACTTGGAGGGCTAATGTGACCTGCAGCTCATCGTGGTCGGAGACCAGTCGTCCGGCAAGAGCTCGGT
CCTCGAAAGCCTGACTGGCTTCTCGTTCCCCCGTGCACCTGGTCTCTGCACCCGCTATGCGACGCAGATCACCTGTTCGC
GCGAGGCCCGCAAAAAAGTGTCGATCTCCATTATCCCTCGCCCTCATGCGGAAGATTCCCTCAAGCGACGTCTTCAGGAC
TTCCGCCGGGTTCTAGACGGCCTGGAAAACGATCACCTCACCAGGGTGTTTGAAGAGGTATGCGTTCACATAGTAGACGT
CCGGGTCTGGTATACTGACATTGCGACAAGGCGAACGCTGCTATGGGGATCCGTATGAGCGCGAGTGACGATTCTCAAAC
GGCCTTTAGCGAGGACATTCTCAAGATTGAGATAAGTGGTCCTGATGTAAGAAGACAGCCTGCCGATGCCTTTGTTTTGT
TGCGTGTGCTGATACAGAGACAGCAAGTCCATCTTACCGTGATTGACGTGCCGGGAATCTTCCGTCTGCCTACGCCAGGT
ACGTTTCTTCCTTCCACCTTGATTCTGTTGCTGACGATGCAGGCCTTACGACCGAGGCGGACGTCGTACTCGTCCGAAAC
ATTGTCAAGCGGTACATGGAGCACAGCCGTACCATGTTCGTCCCTTCTTTGTCCTTGTCCCGAGAAAGCTCTCTTCTGAC
CCATTTCCGGTAGCATTCTCGCCGTTGTGCCGAGCAACGTCGATATCGCCACGCAGGAGATCCTCCGGCTTGCCGAGGAG
GCCGATCCAGAGGGCGTGCGGACCATGGGTGTGCTGACTAAGCCGGATCTAGCAACGGAGCGGGCCACGCAGGAAGCGGT
GGTCGAGCTGGTCGAGGGCCAGCGCAACCGGTTGAAGCTGGGCTACTACGTGGTCAAGAACCGCAGCGCCGATGACGGCT
CTTCAGACACGGCTGAACGGCTGGCATCGGAAAAGGCTTTTTTCACAGCGCCGCCATGGTCTCTGGTGGCCGACCGCTGC
GGCATCCCCCGGCTCAAGGCGCGGCTGCGCGAACTGCTGATGGAGATCACGCGCAGCGAGCTGCCGCAGGTCAAGGTGGA
GATCCGGAAGCTGCTGCAGGCAAGACGGGCACAGCTCAAGACCATGGGTGAGCCGCGGGCCGACGCGAGCAGCCAGCGCC
AGTACCTGGTGCACATTGCGACGCGCATGCAGAACATCACCAGCCGGGCGCTGAATGGATTCTATGCAGGCGAGGCCTTG
TTTACGGAGAAGCCTGGGCTCCGGCTGATCACAAAGGTCATCAAGCTGAACGAGGCCTTTGCCGACACGTTCTGGCGTGA
GGGCCACTATCAGACGTTCGAAGAGGCGTCTGGCTCTAAGACGCCTGTCAGCGAAAGAAACAGCCAAGCAGAAGAAGCGG
ACGAGGAAGATTTTGACGAGGATAACAGCAGACAAGACTTTTTGGACATTCCGGGCAAGGTACACGAAGACCTGATCGAC
ATTGTAGACACGAGCTACCGCTGCCCTAAGCCGCTGGACGGACCGATGACGCCGACGATCCAGAAGGTCTACGAAAGCAA
CCGCGGGCCTGAGCTGGGAACTGTGAGCCTGCCACGTCTGTCTCTTTTTCATCATCTGGCCAAGCTGACATCGCAGTACA
ACGGCACGATCCTGGCGGCAGTGTTTGAGATCCTGTCGCAGAAGTGGGAAGAACTCGCGCTAGCCCACACGAGCCGGGTC
ATCATCCTGGTGCACCAGTACCTGCATGACCTGCTAGGCGAGGTGTGTCCAGACCGGGAGGTGCGACAGCAGATCTGGGA
CGGCATCCTGCGGGACGAGCTGAGCGAGCGGTACCGAGGCGCAAAGGCCCACGCGGAGGCACTGCTGGACGCCGAACGCA
ACACGCCACCGGCAACGTTTAGCCGCCGGTATAGCGAGCTTCTGCAGGCCAAGCGGCAGGCGCGGCTGGCCGACAAGCTG
TCGGGGCTGACGACGAAGTCCGAGGAGGACGAGCGCAGGTACGTGTCGCTGGATGAGGTCGAGCGCCAAGTCCGGCCCAT
GGACATGAATGAGCAGGTGTGCGAGGACGTGCTGGATGCGCTCGGCAGCTACTACACGATTGCGCGCGAGCGCTTCGTCG
ACACGCTGTACCAGCAGGTCGTGTACAACCTGCTGCTGGGCGGGAAACGTAGCCCGCTCAAGGTGCTGGACGCAGACCGC
GTACTGGATCTCAGTGAGGAACAGCTGGGCATGATCGCGGGCGAGGACGCGCTGTCGAGGGCGGAGCGGGCGATTGTAGA
ACACGAGATGCAGAGTCTGGAGGAGGCGATGCGAGTGTTGAGGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62