GenePrediction:GLEAN_896 Details

Name: GLEAN_896
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:730324..732353 (+ strand)
Length: 2030
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:730324..731258 (+ strand)
Length: 935
Type: CDS
Source: GLEAN
Position: GCSC_132:731310..731592 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_132:731731..732042 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_132:732147..732353 (+ strand)
Length: 207
>GLEAN_896 class=GenePrediction position=GCSC_132:730324..732353 (+ strand)
ATGACGCTTCTGCTGTCGACAACCCCACACGCGCAACGAACGAGCAGGATGAGTGCCGCACCCGTGATTGGCCTTTTGGG
CGGCGGGCAGCTGGGGCGGATGCTGTGCGAGGCAGCAGCACCGCTAGAGGTGGAGGTAGCGATCCTGGACGCGGCGGACG
CACCGGCGAAGCAGGTCGGCCACAGCGCGCATCACGTCGACGGCTCGTACAAGGACGCGGCCAAGATCCGGGCGCTGGCG
ACGCGCTGCCGGGTGCTGAGCGTGGAGACGGAGCACATTGACACGGCAGTGCTGGAGGAGCTGGAGGTGGGCGGCCGCGT
GGCGGTGCACCCGTCATGGCGCACGCTCCGGCTGATCCAGGACAAGCACGAGCAGAAGGCGTATCTGGCGGCACAAGGGA
TTCCGGTGGCCGATCAGGTAGCGCTGGGCGACGGCGGCGTGACCATGGCGGCACTGCAGACGGCGACGGCGCGCTTCGGC
TTTCCCTGGATGCTCAAGGCCCGCCGCGACTCGTACGATGGCCGGGGCAATCTGCGGATCAGCGGGCCGGCCGACCTCGA
GCGCGCCCTCGCCGAGTTCGGCGGCCTGCGCTGCTACGCCGAGCGGTTCGTGCCCTTTGTGCGCGAGCTGTCCGTTCTCG
TCATCCGCAGCGAGGACGCCGCTGGCAGCCCGCGCCGTCTGGTCGCCTATCCGGCCGTCGAGACGGCCCATGAGGACAGC
GTGTGCGCTCGCGTCTACTTGCCACCACGCCAGACCGACGCCGCCGTCTGTGCCCGTGCCCAGGCCGTCGCCGTGCGCGT
CGTCGAACACCTCTGGGGCAAGGGCGTCTTTGCCGTCGAGATGTTCGTCGGCCCGGACGGCGACCTCCTCGTCAACGAGA
TCGCTCCTCGTCCCCACAACTCCGGACATCTCTTCACAGAGGCTGTTCCATACATGTACGTCTTCTCCGGACCTTTATCG
ATACCCTTCCACCCCTGACAGATTAGGTCCCAGTTCCGTGCTCAGCTCGCCGCCATCCTCGATGAGCCACTCCCCCAAAT
TTTGGAACCTCACGTGACCTCGGCCATCATGATCAACATCCTCGGCGGCGTCACTGAGCACGCCCACCTGCCGCTCGTCG
CCGCTGCCAAGGCCCTCTTTGGTCACCAAAAGGCCGCCTACGTCCACCTCTACGGCAAGCAGTCCAAGCCCGGCCGCAAG
ATCGGCCACATCACCGTCACCGGCGTCGTGGCTGACGTGGCTGAGCTTGAGGCCTTTGCCCAGCCGCTCGTCGACATGGC
TGCTCAGCTGCGCCTGGACCGTCTGCAGGCCAGCAGCAAGGCCCTGCGGCCAGGAGGACCGACCACAGCTCAGGCTGCTG
CTGCTGCTGCTGCTGCTGCAACCATCACCCCCTCCACATCCGCCAAGCCCCTCGTTCTTGTCACCATGGGCTCCGACTCG
GACCTGCCCGTCCTCAAGGCCGGCATCGACGTGCTCACCGAATTCGGCGTGCCCTTTGAGGTCGACATCACGTCCGCCCA
CCGCACCCCCCAGAAGATGGGTGACGTTGCCGCCAAGGCCGCCGCCCGCGGCATCAAGGTCATCATTGCTGCTGCCGGCG
GCGCCGCTCACCTGCCCGGCATGGTGTCGGCCTACACTGCCCTTCCCGTCATCGGCGTTCCTGTCAAGGCGACACATCTC
GACGGGATGGACTCGCTGTTGAGTATTGTTCAGATGCCAGTATGTTTTTTTTTTCTCTCTTTCTTTTTTTCTTCTACTTT
TATTCTTCTTCTTTTTCCTCTTCTTCTTCTCTCCTGCTACTCCTTCCCCCGCTCACATCCCAGCGTGGTATTCCTACTGC
TACCGTCGGCATCAACAACTCGACAAACGCAGCCCTGCTGGCCATCCGCTGTCTGGGCGCCTTCCAGCCCGAGCTGCACG
AAAAGATGCTCGCCTACCAGCGCGATCTCGAGAAGCAGGTTGACGACAAGGCCGCCTCACTGCATGACCTCGGTGTCGAC
GCTTACCTAGCTAAGATGGGCAAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62