GenePrediction:GLEAN_898 Details

Name: GLEAN_898
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:736643..740353 (+ strand)
Length: 3711
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:736643..737832 (+ strand)
Length: 1190
Type: CDS
Source: GLEAN
Position: GCSC_132:737887..740353 (+ strand)
Length: 2467
>GLEAN_898 class=GenePrediction position=GCSC_132:736643..740353 (+ strand)
ATGGCAGCCCAGGCCGCTGAAGCAGTGTCGATGGTGGCTGCGGTCGCAGATGAGCCGCCGCGGCCGACCTCGCCTGCGCA
TGAGACCGATGAGGAGCTGTACGAGTTCGAAGACACAGTAGAGGAGAGGCCCGATGCGGCCAGTGAGAAGCCAGAAGCAA
AAGCACCGGCGACGGCCGACGAGCCAGAGGAGCGAATCGAGGTTGTCGAGAAACCTGCCGAGGAGCGGAAAGAGCCGCTT
TCCGAAAACCCTGACGATAAGCTGAATGCGCAGGCAGTCGAGAAGGCAGATGAGAGGTTAATGGATGAGCCAGTCAAGCC
GGCCGAGAAGCTAGATGATAAGCTTGTCGAGAATGCTGTCGAACCTGTCGAGCCTGTCGAGCATGTCGAGGAGCCGATCG
AGTACCCCATCGAGTACCCCATCGAGAAGGCTGTCGAGCAGACGGATGCGCAAGAGGTTGAGCTGCCTATGGACAGTCCA
GTAGAGAGCTCGACCGAGAAATATGTCGAGATACTGGATGCGACGCCAGACGAGATGCAGGCGGCTCCAAAAGACAGCAC
CGAGGAGCCAATCGCCGAGTCAATCGAGCTGCATGATAAGCTAGATGTCAAGCCTGTCGAACCTGTCGAGCATGTTGAAC
CTGTTGAATATGTTGGGCCTATTGAGGAACCGATCGAGAAAGTCGTCGAGAAACTGAATGCGACGCCAGAGGAGAAGCAA
GCGGCTCTAAGCAACAAAGCCGAGGAGCCAATGGCCGAGTCAATCGACGAGCCGGTCGAGCTGCTTGAGAAGCTAGATGA
TAAGCCTGTCGAACTTGCCGAACTTGTCGAATCTGTCGAGGAGGCCGATAAGGAACCGATCGAGAAGGCCGTCGAACAAC
TAGATGCAGCGCCAGATGCGACGCCAGACGACAAGCCAGCGACTCCAAATGACAACGCCGAGAAGCCAACCGATGAGCCA
GTCGAGCTAGTCGAGCCTGTCGAACCCGTCGAGCCTGTCGAATCTGTCGAGTCTGTCGAACTCGTCGAGGAACCGACCGA
GAAGGCAGCCGATCCTATCGAGCCTGTCAAGCCTTTCGAGGAACCGATCGAGAAGCCTATCGAGAAAGTGGACGCGACGC
CTGCGACGCCAGCCGAGAAGCCAGTCGACGAGCCAGCCGAGCCGGCGACGGCCGATAGCAAGCCCGATCCGTAAGTGCAT
GCTATGTCGTTCTGTGGGTCCCAACTGACAAAGTACTGTTGCAGATCAAGTCGGCCAGCGTCGAGCTCGAACTCGGCCGA
AGGCCATGACGACTCGGCCAGCGACGAGCAGCCGTCTGCGCCGAGAACGATGCCGACCAGTCCAGAGCCGAGCCAGACGG
ACGAGTCGGAGTCGCCGTCAGCGTCGTCGGCGACGATAGCGGCGACATCAGCCGCGTCGGCCGTATATGCGGTGCTGGTG
TCGCCATCGGTGTCGCCGTCGCCGTCGCCGACGCCAATGGGGCGACTGAAGACCGGCATGGTGGCCGAGGATGAGGACAT
GAGCACGCTACCGGACCCGCGCAAGCGGGCGCTGACAGCCGGCCAGGGAGCCTCGTCGCCGGGCATCGGCAGCCGTCAGT
ACAGCGCAGACAGCGTGGCATCGGACGAAGTGACGACACTGAGCACGAAGCTGATCGACGCGATCAACTACCAGAGCACG
CTGGGCGACACGCTGTCGCGCACGCGGATGGAGCTGGCAGAGGCGCGGGCGCAGATCCAGAAGCTCGAGGTGGTGGCCGA
GCGGCAGAAGGAGATGGTGACTGGCGGCGTGTGGGTGCGCAAGGCGACGATAGAGCAGGAGCGGGCGCAGGAGCGGGCGC
AGTTTGCGGTGCGGGTGCGTGATGAGCGGCGACGTCGCGACGAGGCCGAGCAGGCCAAGAAGAAGATGGAGCAGGAACTC
GAGGCTCTAACGGCAGAGCTGTTTGAGCAGGCCAACAGCATGGTGGCCATGGCCAAGGAAGAGGCCCGGCGCGAGCAACT
GGCGGCGACACGGCGCCACGACAACCTGCGCGCACAGCTGGCCGACACTGAAGGCCTCTTGCGGTCGCAGCAGGAGCAGC
TGGCCCAGCTGAAGCAGGTCATGGAGGACATGATCACCGAAGGCGCAGCTGCCCAGGCGGCCATCGAGGCCAACGCCCAA
GCCGCTCAGGCCGCTGCCCAGGCTTCCGAGGAGCAAGCAGCACGCCAGGCTTCCGCCAGCCGACAGGCCGGCCATGCTGC
AGATAAGCTCGGTGGCCGGGGCGGGGCTGCTGCTCGGCGCGATTTCGACGGGACCGACACGGACGTCTCGGAAGACGACG
CCACAGGTTCAGCCACAGGATGCTCAGCCACAAGTGGCTCAGCCACAACGCCTGCAGTCGACCCCCCCTCGCTGCTGCCA
CCGACTCCGCCGTCATACCCGACCAGCTTCACCCATCTGGTGCGGCCGGTCCTGCGGTTCGACACGGCAGCCTATGCCGA
GTTCCTCGACCTCATCCGTGGCGCACAGGTGCAGATGCTGCACCAACACCAGCAGCAGCTGCATCAGCAGACGCTTCTGC
CTCACGCGCGGTCGCCATCATCCATCTCGATGCCCAGAACACCGCCGATAATGGCCAGCAGCAGCGACCTGGCCGCCACG
ACGCCGCCACCATCATCACCGGCACCCACAGCGTCGTTTGCAAACCCATCGCCGTCGCTGCTGTCGGCCATGCCGGCAGC
CATCATGGGCAACGGCGGCAGCAACGGCAGCATCCCGTCGCCAAGCAGCTCGTTCTCGCAAGCCGGCACGCAGCACGGAT
CCAGCGGCCTGAAAGAGACCAAGTTTTACAAGCGCGTGCTGGTTGAGGACATTGAGCCGGCCCTGCGACTGGACACGGCC
CCAAGCATCTCATGGCTGGGCCGCCGCGGCATCATGTCGGCCATGCTGGAGGGCACGCTGGTGGCCGAGCCGATGCCCAG
CCTTGGCGGTCTTTCGAATGGCTCGACCCATTCGTTTGCCTCGGCCGGCGGTTCAGGAGGCTCCGGGCCTTCGCCGTATG
GCGCGCTGTCAGCCAGCGGCTTCTCGTTGTCTCCGGCCATGGCGGCTTCAGGCTATGCTTCGTCGTCGTCGTCGTCGTCC
GTCACCATCTTCAGTCCATGTGCGCTCTGTGGCGAGAGCCGACGGGAAGAGGCCCATCTGCGACGACACCGGTTCCGGTT
GACAGAAAGCGACCGGAGCCCGCCATATGCGCTGTGTGGCTACTGTCTAGGCCGTGTGCGAGCCGTCTGTGACTTTCTCG
GCTTTCTGCGCATGATCAAAGATGGTCACTGGCGTGCCGACGACGCCAACGCCGAGCACGCTGCCTGGGAAGAGGGTGTG
CGTCTGCGTGAGCAGATGTTCTGGGCTCGCATCGGTGGCGGTGTGCTGCCTGTCGGCACGCTGGCCGCCGAGAACGCCAG
CAGCAGCAGTCGTGTTGTCAGCAGCAGCAGCTACAACAACAGCCTTGCTGGTCGGCACTCGCGCATCGTCAGCAGCCAGG
GCCTCGGCATCACGGCCACTCCGCCAGCAGCAACGACGACGGCAGCCGCGTCCATGGCTGATTCAATGTATGCTGCGTCC
TTTCACTCGGCTCGGTCGCAGCAGCCGCCAGTGCCGCAACTGCCGGCTCGGACCGTGCTGTCATCTTCCATGGCCGCTCT
GGTGGCCGGATTTGGTGGACATGTCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62