GenePrediction:GLEAN_899 Details

Name: GLEAN_899
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:751871..752942 (+ strand)
Length: 1072
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:751871..751970 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_132:752026..752942 (+ strand)
Length: 917
>GLEAN_899 class=GenePrediction position=GCSC_132:751871..752942 (+ strand)
ATGACGTCCGACCCCAACTTTGACGAGGCCACCCGCATCACGCGCCTCGATGCCACCACATACGGGGCCAACTTCCCGGC
TCGATACTGCATCGGATCCGGTAAGCTACCTTGTCCGTGCCACTCTTGCGCACACCCACACCTGCTGACCTGCAGTCCCC
CATGGCGGCTTCATCGCCAGCTGCTTCCTGCGCGTCGTCCAGACGCACCTGGCCGGCCGTGGCCAGCCCGACACGGTCAT
TGCCCACGTCGAGTACGTCAGCCGGACGGAGATCGGGCCGGCCGTCTTTGTCGTCGACGAGGTCAAGCTGGGCCAGCGCA
CCAGCGTCGTGCACGTCAGCCTGTTCCAGCATGCCCTGGCCACCCAGGCGCCCTGGATCACGCCGGGCCAGTCGCGCCGC
GAGGCCGTGGCTTACCTGACCAACTCGGCCCTCGATCGCGAGACCGGCCTCAGCCTGCCGACCGGCTATGTTCTGCAGCC
GGCAGCGCTGCCGCCGCCACCACCGCCCGCTGACTTTGCCCGCCTCGGCCGCGACGGTGTCGACGACCACTGGCAGCGCC
GGCCCATTCCCCCCGGCAGCTATCGTGCCGTCATGGCCCAGACCGAGTTCTACGTGCCCAAGTGGCAGCTGCAGCAGCCG
GAATCCCCCCCCAAACATCATCCCTCTCCCCAGCAGCGCTCCATCGTCGACATGTGGATCCGCCTAGCTACCGGCGAACG
CTTCACCAACACGCTCCTCGGCTTCGTCGCCGACGTCTGGCCCTACGTCGTCGAGTCTTATCGGCCCCAGTCTGACGATG
ACCCCGACGATGCCTACTTTGACCCCAGCCAGATCTTCTGGTATCCTACCCTCGCCCTCAATCTCGACGTCAAGAAGGCC
CTGCCGCCCGATGGTGTCGAGTGGCTCTTTGTCCGCATCGCCTCCAAGCAGATTCGCAATGGCCGCCTCGACCTCGAGGT
CGTCATCCTGGACGACCACCACGACCTCGTCGCCCTCAGCCATCACGTCTCGCTCATCCTCGATGCCTCGCGCAACCTCT
CGGAGCGGAGCCACACTAAGAGCAGCATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62