GenePrediction:GLEAN_89 Details

Name: GLEAN_89
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:581421..585436 (+ strand)
Length: 4016
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:581421..581609 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_179:581681..582169 (+ strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_179:582266..582468 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_179:582515..582811 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_179:583243..584218 (+ strand)
Length: 976
Type: CDS
Source: GLEAN
Position: GCSC_179:584384..585436 (+ strand)
Length: 1053
>GLEAN_89 class=GenePrediction position=GCSC_179:581421..585436 (+ strand)
ATGGAAACGGAAAAGTTCCACCAGTGCTTCGACTGTCCCGATGGCGTGCAGATCTTCTCGACAGAGGACGAGCTCATGGC
CCACAAGTGGGACATGATCCGCACCGAGATGTCGCGGGAGCACATGAACTGCCACATCTGCGGCATGAAGCATCGCACCT
TTGAGGGCCTGATCCGCCACTATCAGCTGGTGAGGCTCCGTCTTGCAGAACGTGCAGAATTCATCAACTGTGAAGTTCTT
TCCTTGCTGACGCGCAACAGAGCCATCCGGCCAAGCAGAAGCTCGCCTGTCCCGGCTGCCGCACCGTCTTTCCTCGTCTC
CACCTGCTGATGGACCACATGGAGGGCAACGACTGTCCGAACGTGACGGCTGCCCAGGTCGGCGACCGTCGGATGCGCAA
GGCCCTGGCAGCCGCTGCTGCCGGCAACGCGTCCAGCGCCGCCTCCGAGATTGGCATCTTTGACGTCGGTGGACGGGTGC
CGGCGGCCGGCTACGGCCAGTACATGGGCCTCGACGTGCCGCCGCCTCCGGCAGATCCCAAAGCGATCGAGGACGGCAGG
CGGGAAGCGATTCGACAGGGAGGCTCCGGCCGAAAGTCACGTCCGGCGATGCCGTCGCAGGCCCTGGTCGCAGCCACGGC
CACGGCCACGACGTTTGCTCGCACAGCCCGCGAGTTCCGCCACGGCGACTCCAAGCTGCCCGACCTGCTGACCGACAGCC
CGGCCGACGGACGACACCGCGGACTGGACGTCTGGTCCGGCCAGGACATGCTGGGACTGGGCGACAACAACAACAGCAGC
AACAGCAGCAGCGTGGAGCCGAAGCACGCGCTCCTTGCCCGCCAGAGTATCGGCTCGCCGGCCGATCATCGCGGCAGCAC
GGCCCCCAAGAATCGCTCCCAGCAGGTCTCGTTGCCCGGCAGCTCAGCCGAGGCGGGCAGCTCGCTCGATCCCAACCACC
CGAGCCACCCCGACTTTGACGTGTTCCGGTACAAGAACCGGATCACGGGCAGGTTCAACTGTCCCCACATGGGATGCAGA
CGAGCAGGGTGAGTTGGAGTTTACATACGCACACATACACACGCTGACCATTAGGAAATCGTTCAAATCGGCCTCTGGCT
TCATCACACACCTGCGGTCGGACGCAGCTCACACATCGCTGCGCGTGCAGTGCCCGTCGTGCTCGCGCTACTTCACCACG
ATCCAGGCTCTGGTGCAGCACAGCGAGTCACAGTCGGCCCGCTGCCACCTTCGCGATTCGGAAGAGTTTCACCACTTTCT
CGACACGCTAACAGGCGGCATGGTCGCGGTGCAGGGCCGCAACATCGACCTGACCGTCGCATACGAGGTGCAGCCCGGCG
CGGTCAGAGACCTGCTGCCGAACGGAGAGATGTAATCTAGAAGGCGCAGATGGCACAGATGAGCAGTAACATCCAAGTGG
AGGCGGTGCATAGCTTGCATGAATAATATACCGTCGCCCTGTATTAGTTTGATGGCTGCAGTTCCTCAGGGGCTTCTGGC
CAATCAGCAGTCAGCATTGCTTTGTCACAAATGCCCCACACATTCCTTCTGCAAGCTGGCGCGTCGTCTCTAATCTGTTC
TCACAGCCCCCAACGACGCTCTCTCTCTCGCGTCTTTTGGCTGTCAAGTGTCGGGTGCCGCAGTGACAGATAATACGAGT
TTGTGTCAGCAGAGACCCGGTACTTCAATTTGCAGCTATAATTATCGCCGATCGGCCTGTCGCTTCACCTGGCTTTTGGC
AACGATGCACGTCTCGTTGTCGGTCTCCTTTTCGATTATCCGGTGAATCCGACAGAAAACAGCCCTGTTCTGATGGACGG
AGATCGCGACGACCACGACCGCGACAGAAATAGCGACCGTCCACGGCCGTTTGAGCACTTTGAGCAAGCAGCCCGCATCG
GCGAGCACAACGACGACGGCCATCACCGCCATCACGGCCACCACAACCGAGCCATGCTTTTGACCCGACGGCTCGCGCGG
CGGGTCGAGCGCAGCTGCTGCCTGTGCGCACACTACTTCCCGCTGGCCTTTGTGATCGGGCTGAGCAGCTGGGCATGCTG
GGTGATGCTGCGGCTGGGCAGCCGAACAAGGAGCGAGGGGAGCAGCAGCAGCGACACGGCAGCGTCATGGGTCGGTCCAG
GCACGGCAGCAGCAGCGGTGGTGCTGTACGTGCTGCAAATGTGGTCGTACGGCACGGCAGTGTTGACGGCACCGGGCAGC
ACGACAGACGACCACGGCTACAGCACGGTGCCACCGACGGCGATGTCGGGGTCCGGCAACAGCCATGCCGGCATCACAGT
CAAGTCCAACGGCGAGCTGCGGTTCTGCAAGAAGTGCCAGGCCCGCAAGCCGGACCGGGCACACCACTGCTCGACATGTC
GGCGCTGCGTGCTCAAGATGGACCATCACTGTCCCTGGCTGGCGACGTGTGTCGGCCTGCACAACGCCAAGGCCTTTGTG
CTCTTTCTCGTCTACACCACCCTGCTGGCCTGGCTCTGTCTGGCTGCGTCGACCGCCTGGGTCTGGACTGAGGTCGTTAA
CGACACCACGTACGACTCGTACGACGACTCGCTGATGCCCATCCAATACATCATGCTGTGCGTCATCTCGGGCATCATCG
GCCTCGTCCTCGGCCTCTTCACCGGCTGGCACATCTACCTGGCCTGTCGCGGCCAGACGACGATCGAATGTATGGAGAAG
ACCCGGTACCAGTCGCCGCTGCGGCAGTCAGCTGGCGGTGGATGGAGCGGCAAGACCGGCGGAGGGGGTGCCTTTCGCGT
CCATCGCCAACGCCAGCCGCTGGCGGACGAGGAGCAGGGCCTGTTTGGGAATGCGGCCGACGACGGCGACGACAACGACA
GCAACCGACACTACAACGACACGGACTACGACGACAACGGCCCCCATGATCACAACGATCGTATACACCGACCCGATCAG
CAGCTCGGCCGCCGTCTCACGTACGACCAGATGGAGCGGTATCGTGCGCAGAAGCGACACCAGGAGTACCTCGACGAGCA
GGACGGCAAGCTGCTGCCGCACGCATTCGATCTGGGCGCGCGCCAGAACCTGCTGCACCTGCTGGGACCACAGCCGTGGC
TCTGGGCTCTGCCGGTCTGCAACACCACCGGTGACGGCTGGTCCTGGGAGCCAAGTCCGCGCTGGCTGGCCGCCCGGGAC
GGCATCCTACGCGATCGTGAGGCCCAGAAGGCGCGTGAGCGTGCCGCCGGCTGGGGTCCGGTCGAAGAGGAGGGGGGAGA
GAGTTTGGGACTGGGTCCAGGACTAGGGCTAGGGCCAGAGGCAGAAGACGAGAACGGTTACAGCACAGCACCGACGGCAC
CACCTCGTTATGACAGCACGACAAGTGCGACGAGTCCGCCCAGCCGCTTCTCCACGTCCAAAGCCGATCGGATCTTGGGT
CGAGACCCGCGCCTGTACTCGGACGAGACGCCCAGAAGAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCGAGACGTC
TTCGGCGCCCGTCTTTTCGATGCAGCGTCTCACGACATCGGGTCGGGCGCTTCGACGCGGACAGCTGCCGCGCATCCTCA
ACGACTCGATCCTGGACGGTTCGGACACGGACGTCGACTCGGACGACGAGGAGGAGCGCCGCGAAAAGGCCAAGGACGAG
GCTGCAGCGGCCGAGGCCCGACGACGCCTCCACCAGCAGACCCATCAGGCGCTGGCACCGCTGCGGGCCCGCTGGCTGCC
GCAGCCACAGCGCAGCGCCGGTGCCAGCGGGCTGCTCCTGCGCCAGACGACGGCCGCGGTGTCGTCGTCGTCGCTGGCCT
CGTCTGCCGCCACGTCGCCGCTGGTGTCGCCGTCACGCGAAAGCAGCGTAGGACCAGCTGGCGGCGTCGGATCGGTCGGG
ACTGTCGCTGCCGGGATCAGCACAGCCGACAGCGTGAGCATCATCGGCAGCAGCGACAGCAGGGCAGCCGACACGGATGA
CGGCGGGGTCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62