GenePrediction:GLEAN_900 Details

Name: GLEAN_900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:754380..754974 (+ strand)
Length: 595
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:754380..754483 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_132:754596..754974 (+ strand)
Length: 379
>GLEAN_900 class=GenePrediction position=GCSC_132:754380..754974 (+ strand)
ATGGGTAAGAGCGCAGGTCTGCGGTCCGGTACGCGGTACGCCTTCTCGCGGAAGTTCCGTGAGAAGGGCATGATCCGTCT
GTCCACGTATCTCAAGACATACCGGTACGTACGATTTGGCGGAAGACGTTTTCTTGACCATTTGCGCTCTTTCTGCAGAG
AAACGACGCTCTTGCTTCTCTTTCTCCCTTCTCCGCCACGCTCGCTAACAAGAAAGGGTGGGCGATATCGTCGACCTGAA
GACCAACGGTGCCGTCCAGAAGGGCATGCCCCACAAGGTCTACCACGGCAAGACGGGCGTCATCTACAACGTGGCCAAGA
ACGCCGTCGGTGTGATCATCTACAAGAAGGTCAAGCACCGGTACCTTGAGAAGCGCGTCAACGTCCGCATCGAGCACATC
TCGCCGTCCCGGTCTCGCGACGACTTTCTGCGCCGCGTCAAGGTCAACGCCGAGCTCAAGAAGCAGGCCAAGGCCACCGG
CACGCCCGTCCAGCTCAAGCGGTTGCCCACCATGCCGCGTCCCGCCCACACCCTGTCGCTCGACGGCAACGCACCCGAGA
CCGTCACCCCGATCCCCTACGACACCGCCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62