GenePrediction:GLEAN_902 Details

Name: GLEAN_902
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:765502..766456 (+ strand)
Length: 955
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:765502..765515 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_132:765598..766456 (+ strand)
Length: 859
>GLEAN_902 class=GenePrediction position=GCSC_132:765502..766456 (+ strand)
ATGACTCTGGGAACGTAAGTGCATTGTATTGTGCTGCATACTTTTTATTGTCTTCTGTCTTCTACACAATCTGCCAGCCC
ACTAACACTACGGCAGGACAAGCTCACATCATCTGACGTCTTCTGCCCCTGGCTCTGCGGGCCACGACAGAGCCGCTTCT
GGCACGTGCTCTAATTGCTTTGACAAAGACGACGGAAAAGGCATCAAGGTCACAAATGAAGGCAATGCTTCCAACACCTT
CTCTTTAGACCGCGGCTTCGGTAGCGGCTTCTCGAACTATACGGCCCCGAAGCCCAAACCCGACAGCGGCTTTTCGTTGC
TGCCGACGACTTTCGACAGAACTCGTCCCAGTATTTTTGCTCCGGATAGCTACCAGACGGCTTCCCGCTATCCGCCCTCT
CTACTTCGCCCCAGTCTCTTTTCAAGCGTCCTTCCCGAGAGGCCTGTCGGGGCTGCAGCGGTCAAGCCGACCTGGAAGCA
CGACACCACAGAGGGCAATAAGAACAAAGAGCACGACAAAAATGGTCGCTCCGATATGGTCGACACCTCCGTGAGAGACA
TCCTTGGGTCCACCCAGTCCGACAACAGCGATATCGTCCGCTTGACCGAATCTGTCAGCCGGATCGAGCGCGACCTGGCC
GGCGTGTTGGCAAGCATCCACGAGCTCCAGAAAGATGTGCAAACCGCGCTGAACGCAGCGGCCAACACTGACGCCGGTGC
CGATGCCGACGCTGCGGACAGCGAGAGCACGGCTACAGAAAATGTCGAGCAGACCCACGGCTGCGACGACCTCTATCTCT
ACGGCCAAGCCCAAGTCTCTGGTTGCCACGCCCACTGCTGTGGCTCCCACCCCCACTTTAGCTTGTCGCCGACAAGGCTT
CACACGACTTTCCACCGGAGACAACACCACTGCGACCGGTGCGGCAGTCACGTCCACAGCTCACGGATGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62