GenePrediction:GLEAN_904 Details

Name: GLEAN_904
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:771031..773093 (+ strand)
Length: 2063
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:771031..772668 (+ strand)
Length: 1638
Type: CDS
Source: GLEAN
Position: GCSC_132:772926..773093 (+ strand)
Length: 168
>GLEAN_904 class=GenePrediction position=GCSC_132:771031..773093 (+ strand)
ATGGGCTTGACGGCCTTTCTCGTGGTCTACCTCTTTGGAGGCATGACATTTCTGCCGCTCCTCATCGCGGCGATCATCTA
CGTCTACACGAAGCCGGTGCCTCCGGGCGATGGAGCAGACGGCTTGACACGGCCTGGCGATGACCTGGCGGCGCTGGAAA
ACGCGCGTCGCGAACACGGACACGAACACGACTACGACCAGGGCCACCGAGGCGGGACGGAGAAGAAGAGCCGGTTCGAC
CAGCATCACCATCATGTAGACGACTTTGCGACGGCCGGTTACTTTGCAGTGTTCCGCGAATACGTGGCCATTGGAGTCAA
CTCGAAGCCGGTGGAGCCGTCAACCGTGGGGCCGAACACGGTGGCGCCACCCAGCCCGAGCGTGTACCAGACCTTCTTCC
GCAACATGCTCACCAAGAAGGGGAGCAGCTCGGGCGGAGGAGCCGGAGCAGGCGGTGGGGTCAGCGGCGGGAAGAGAGTC
GTCGGGGCCGCACAGGGACAGGGGGCGGTGGCATCGGCAGCAGCACTGGCAGCCGGAGCAGGCGGCAAGGGCAGCGGGCC
GGTGATGGTGGAGGTGAGCAGTGCGGCCAGCCCGCGGCCGAAGAACGCACGCAACATGTTCTACGTGGTGCTGCGGCACG
GCCATCTGATCCTGTTTGACGACGACCAACAGGTGGATGTGCGTCACGTGATCAAGCTGGCAGATCACGACGTGACGGTG
TATGCAGGAGCGGGCAAGCGGGTGGTGCCGGAGGGAGAGCTATTTATCAAGCGAAATGCGCTGCAACTCAAACCACGACA
CCCGGAGCGAGCAGTGCGGGCACACAACGCGCCGGTGCCGCAGCCATGGTATCTGTACAGCGACAACTGTGCGGAGAAGG
AGGACTTTTACTTTGCGCTGCTGCGCAGCCAGAGCCAGGAGGCGGCGGGGACTCGGGGGGGGTTGGGCGAGCCACGGGCG
CGGGCGATCGAAGTACGGCACCTGACGAGCCTGATGGAGCGGCTGCACGCGTCGGAAGAGGCGGCCGAGATGCGCTGGCT
CAACGCGCTGGTGGGCCGGATGTTCCTGGGGGTGTACCAGACGCCGGAGCTGGCGGCGTTTGTGAAGAACAAGTTTGTGA
CAAAGCTGTCGCGGGCTCCACGGCCGGGATTTGTGGCGAGCCTGGAGGTGCAGCGAGTGGACCTGGGAACGACGACGCCG
CAGATCACGTCGCCACGGCTGCGCAGTCTGACGGCCGAGGGCGAGTGCGTGGTGGAGGCAGACGTGCGGTTTACGGGCCA
CTTTGGGATGGATGTGGCGGCGACGTTGCGGGTCAACACGCCGATCGGGACGCAAGAGGTGCGGACGTCGCTGGCGGTGG
CCTTTACACGGTTGGAGGGCCCGGTGCTGTTCAAGATCAAGGCGCCGCCGAGCAACCGGCTGTGGTTTACGTTCCGGCAC
ATGCCCAAGGTAGAGATGGAGATCCGGCCGATCATCGCGGCGCGGCAGCTGACATGGCCGCTGGTGATCCAGATGATCGA
GGGCAAGATCAAAGAGACGATTGCGGAGAGCCTGGTGCTGCCGTTCTGGGAGGATATGCCGTTCTTTGGGACAGAGCGGA
AGCGGTGGCGAGGGGGCGTCTGGGAGGATGACAGCGGCGTGCCAGGCGAGGAGGGAGGAGAAGGGGTAGAGGGAGGGGAG
GGCGTGGAGAGAGGGGATATGGTGGAGGGAGGAGAAAGGATGGAAGGCGGGCCCGAAGACAGCATCGAGACGGATGGCGT
AGACGCCGAGGTAGCAGCAGCAACGACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACGCTGACGACGGGCA
GCGAGAACGTGTCGCCAGCGGTATTGCGGCTGCGGAGGCTTAGCCAGAACTACAGCGCACCGGCGATGGTGTCGTCAACA
TCGTCGTCGTCGGACGGAAAGGGGCCGTCGCCCAAGAAGAGCAAGCAGCAACAGCAGGCGGTCAGCGAATCGGGCAGCAC
ATCGAGAAAGTGGCTTTCGCGCAGTTCCCGACAGCGACGAGCGGAAGAGAGACAAGAGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62