GenePrediction:GLEAN_905 Details

Name: GLEAN_905
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:773509..774153 (+ strand)
Length: 645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:773509..774153 (+ strand)
Length: 645
>GLEAN_905 class=GenePrediction position=GCSC_132:773509..774153 (+ strand)
ATGAGCAGCAGCGGCGAAGCTTTGGACCTGAGCAAGCCGATGGGCGGCGGACGACCTCTGCCACCGCCGGGAGAACCGCT
GCCGATGCCGGGAGAGCTGTCGAGAGGGGGAGGAGTGAAAGGAGTGACTGGCAGACGGAGCAGCGTTGTGGCACGGAAAC
CGGTGCCGCAGCCACAGCCGAGGAGGACGGCATCGAGTGAACAGATGCGAGCACAGCAGGAAGAACGGCTGCAGCTGGAA
CGACAGCGACAGTGGGAAGCACAGGTGGCGCTGACGGGAATGCGGCAGGAGGGCGACGTGATGGTGTTGCAGGCGCCGGT
GGATTCAGACGAGGAAGAGGAGGTGGAAGAGGAGGTGGATGAGATGGAGGAGAGCCGAGTGGAGAATTCGGATGAGAGTC
GAGTGGATCTTGTGGATGAACCAGCGATCCCAGAAGACGGCGAGGAAGACGACGGGCTGGCGGCCTGGGACGTGGACTAT
GAGACGGGGGGAGAGACGGGAGAGACAGGAGAGACAGGAGGAGAGATGGGAGGAGAGATGGAAGGAGAGACAGAGACGGA
GAGAGAGACGAAGAGTGGAGAGATGTCGGGGGAACAGACTGCAAGGACAGAGGGAACCGAAACGGCAAGAGACGAGCGCA
CGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62