GenePrediction:GLEAN_906 Details

Name: GLEAN_906
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:776108..777339 (+ strand)
Length: 1232
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:776108..776253 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_132:776334..777339 (+ strand)
Length: 1006
>GLEAN_906 class=GenePrediction position=GCSC_132:776108..777339 (+ strand)
ATGTCAGAACGTGTCACTACCCCTGACGGTTCTGTGGCCGGCTTTCTGGCCACGGCTGGGCCTGTGCCCGCGCAGCTGCC
GTCGCAGCAGAGCGTCGTCGTGCCCGTGAAGAATGCGAAATCATGGTCTCACATGGTAGCCGGAGCGTACGTTGAGCCTC
CTTTGTCTTGCACCCTTTTTTTCTCTTGTCTGCCCCCCTCTCTCTGCCCGGCTGACATGGTCGCAGTGTCGGCAGTCTGG
CGGCCGCGACCGCGACCGCGCCGTTCGACGTCATCCGGACACGGCTCCAGTCGGACTTTTACCAGCAGCAGCAGCGAGCG
CGAGCAGCAGCAACAGCCGCAGCCGCAGCAGCCCAGGCCGGCCGCAGCAGTGCTGCCGCGATGGTGCCGCCGTCGACGGC
CAACCCGCTGCGCGCCATGGGCCGCCACCTCGGCGAGACGATGCAAATCTTTGCGTCCGTGCAGCGCAACGAGGGCTGGC
GCGCGCTGTTCAAAGGCCTGGGACCCACGCTCGTCGGCACGGTGCCGGCCAAGTCCATCAACTTTTATGCGTACGGCAAC
GGCAAGCGGCTGCTGGCCGAGGCCGCTGATGTCAGCCAGGACACGCCCTGGGTGCAGCTGGGCGCCGGCATCGTGGCTGG
CCTGGCCACGTCGACGGCAACGAACCCGATCTGGCTGATCAAGACCCGACTGCAGCTGGACCGAGAGGGCCCGACAGCTT
CTCCCAGCTCGACCCACCGCCGCTACCGAAACTCTCTCGACTGCGTCCGCCAGGTCGTCCGCCAGGAAGGCGTCCGCGGC
CTCTACAAAGGCATGACGGCCAGCTATCTCGGCGCGGCCGAGTCGACCCTCCACTGGCTGCTCTACGAACAGCTCAAGCG
CGGACTCGCTCGCCGCCAGACCGCCGCCGCTGCTGCTCGCCCTCCAGACGCCTGGGATCGCTTCGTCGAGTGGACCGGTC
CCCTCGCCGCTGCCAGCGCTGCTAAGCTGTGCGCTACCCTCCTGACTTACCCCCATGAGGTCGTGCGCACGCGCCTGCGA
CAGGCTCCCGCTGCTGACGGCCGCCGCAAGTACACCGGCCTCGTTCAGTGCTTCTTGCGCGTCTGGCGTGAAGAGCACAT
CGCCGGCCTCTATGGCGGCCTCACACCACATCTGCTGCGCACCGTCCCGGCTGCCGGCATCACCTTTGGCATCTACGAGA
TCGTCCTCAAGCTGCTGAACGCACCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62