GenePrediction:GLEAN_907 Details

Name: GLEAN_907
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:777714..778153 (+ strand)
Length: 440
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:777714..777839 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_132:777902..778153 (+ strand)
Length: 252
>GLEAN_907 class=GenePrediction position=GCSC_132:777714..778153 (+ strand)
ATGGAGCCCACGTCGTCGTCCAAGCTGCGCGTCCGCGGCATGATCCTGACGGCCGGCGTTGCCGCTATCACCATGGTCGG
TACCTTTTATGGCGCCGGCCTCAAGTCGGACCAGGAGGCGAAAGAGGTGCCGTCATGCTCTGCTCGCTCGTTCCGCCTTC
ACTGCGCCGTGGCTGACCCTTTGTCCAGAGAAGAAAGGCAACCGCCGTGCTGTCCTCCTCGTCACTGCCGCCCTTGGCCC
CCCTTCCAACTACTTCCGTTTCCGCCCCGCCGGAAGACGAGTTCATCGCTGCTCTGCAGACTCGCCGCCGCGCTATCGAA
CAGACCAAGAAGAACTGGGAGGCCAAGGCGGCCGTGTTGCGCGAGCGCATCGAGGCCAACAGCCGACGAGATGTCCCTGC
TGGTAGCAACAATGGAAATAGCGCAGACACGGCAAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62