GenePrediction:GLEAN_908 Details

Name: GLEAN_908
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:786644..787115 (+ strand)
Length: 472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:786644..786686 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_132:786779..786850 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_132:786907..787115 (+ strand)
Length: 209
>GLEAN_908 class=GenePrediction position=GCSC_132:786644..787115 (+ strand)
ATGGACCGGGAAATCTACATCAAGTTTAACGGTGGACGAGAAGGTGAGCTCGAGGTGGAAGGAGCTGGAGGATGGAAGAA
AACCGAGGCATAGAAGAGGCAAGAGGCAAAAGCAAAAAATCGCTGACAATTCCAGTCTCGGGCGTGCTCAAGGGCTTCGA
CCCGCTGCTCAACATGGTGCTGGACAATGCCCAGGAGAAGATGCGCAGTACGTGATTTGGCCCCTCGAGTCATCACCCCA
GTACCCCTCTGACCAGATCCTAGACGCCGATGGCGAGACCAAGTCCCGGTCGCTCGGCCTGGCCGTCATCCGCGGCACCC
ACATCACCACACTGCATCCGGTTGACGGCAGCGAGAGCATAAGCAACCCGTACCTGGCGGCGGCCGAGGAGGCCGGCGGC
GACGCGCCCGCGTACCAGTACACGCCCAAGCCCGAGGACGAGGACGAGGACGTGGAGATTACCGAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62