GenePrediction:GLEAN_909 Details

Name: GLEAN_909
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:791335..793064 (+ strand)
Length: 1730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:791335..791472 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_132:791538..792754 (+ strand)
Length: 1217
Type: CDS
Source: GLEAN
Position: GCSC_132:792887..793064 (+ strand)
Length: 178
>GLEAN_909 class=GenePrediction position=GCSC_132:791335..793064 (+ strand)
ATGGCCACTCCAGCAAGCTCGGCTGCAGCTCAGCTGTCTCCACAAGAGCAGGAGTCTCTCGATCAGCTAGTGTCCATCAC
AAACCAGACGCAGGCAGAGGCCGTCGGCCTGCTGCGGAGGTCGAACTGGAGCGTCCCGGTACGCCGTGCTGCTGACTGTG
ATGCTTGTAGGAAAGAAGAGAGAAGGCCTGCTGACTCAGACAGGTTGCCATTGCCAAGTTCTTCGATGGCGAGCAGGAGC
AGATCCCGCTCGAACCGCTGCCGCCCCGCCCCAACGGCCGCCGCGCAGCCCAGCCGTCACTGCAAGACCAGCTGCTGCAG
GCAGAATACAACGGCCGCCAGGTGCAGCCAGTCGAGCGAACCGAGGCAGCCCGCCGGGTGGTGCCATCGCCACCGACGCC
AATATGGCGGCCACCGCTGCTGGTGGCGCTGTTCTTGTCGCCGCTGCACCTGAGCTACCGCGTGCTCGTGGGCCTGTGGA
GCGCAGTGCAGTATCTGTCGTCGTTTGTGCCGTCTCTGCGACGGCGGCTGGGGTCCGGATCCGGGTCTGGGCCAGGAACA
GGATCAGGAACAGGGACGGGAACAGGACCTTCGCAGCGGCTGGGCCGGCGACAGCTGAGCCCGCGAGACGCAGCCGCACG
GTTCCGGCGCGAATTTGAGGAGCAGTACGGCAGTAAGGCACTGCCATTTGCCGAGGACGGATACGCGCAGGTGTACGACC
GAGCCAAGGCGGAGCCCAAGTATCTTCTGGTGGTGCTGCTGTCGCCGGAGCACGACGACACGGACCGGTTTGTGCGCGAG
ACGCTGCTGTCGCCCGAGGTGACGGCGATTGTGGCAGACCCGGCCAACAACTTTGTCATCTGGGGCGGCAACGTGCGGGA
TGCCGAAGCCTTCCAGGTGTCAGCCGAGTTTCAGGCGACACGCTTCCCCTTCTCGGCCGTCGTGTGCGTGACGCCCAAGG
AGGGCGGCAGCACGCGTATGGGCACGATCAAACGCATGACCGGACCCATTCCGGCCCAGCTGTACGCCGCCCATCTGCGC
GGCACCATGCAGCGCTATGCCGACGACCTGGCGGCCGTGCGTGCCGACCGCGTCGACCGCGAGTCTAGCCGGAACCTGCG
GGCTGAGCAGGACAGCGCCTACGAGCGGTCGCTGGCCGCGGATCGCGAGCGTGCCCGCCAGCGCCAGGCTGCCGAAGCGG
CTGCGGCTGAGCGTGAGCGGATGCTCTGCCAGCAGGAGGCCGAGGCGGCCCGCCAGGTCAAGCTCGCCCGCCAGTGGCGG
CGCTGGCGCCAGGCCCAGCTGCTGCCAGAACCGGCCGCAGGCACAGCAGGGGTTGTGCGTGTAGCTCTCAAGCTGCCCGA
GTCGTGTGGGGGCGAGCGGGTGCGACGGGCGTTTGACCAAGACGTTCCGGTCGAGGAGCTGTACGCCTTTGTCGACGGAC
TGCTGGCCCAGAAGGAGGAGGAGCGGAGGCGAGCAGAGGCAGACGACGACGAAGACGACGACGACGATGCGAGCGACAGC
AACACGAGTGACAGCGAGGAAGAAAAAACCAGACCGCAAGGCTACACGCACGAATACAAGTTCCGGATCGCATCCATGCT
GCCGCGAGAGGTACACGAGCCGTCCGAGAGCAAGACGATGCTCGAGGCCATTGGCAAGTCAGCCAGCCTGGTGGTGGAAG
AGGTGGAGGACGAGGAGGAGGAAGACGAGGACCATGACCTCGACGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62