GenePrediction:GLEAN_90 Details

Name: GLEAN_90
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:610322..611438 (+ strand)
Length: 1117
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:610322..610339 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_179:610404..610643 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_179:610695..610730 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_179:610793..611238 (+ strand)
Length: 446
Type: CDS
Source: GLEAN
Position: GCSC_179:611303..611438 (+ strand)
Length: 136
>GLEAN_90 class=GenePrediction position=GCSC_179:610322..611438 (+ strand)
ATGACGCCCGCATTTTCCGTACGTCTCGCGCCTTGCTTTGGGGGATCTGGCCTGGTGCTGGGCTCGCTGCTGACCGCCAC
AGAGACTTGTCCGCTTCCTGGCCAAGGACGGCCGGACCTACTACGGAGACGCGATCCTGCCATCGGGCGTGACGGACATT
GCGCAGGCCAAGCAGGCTCGCATCGTGGTCGGCAATGTGTTTGGCAAGCACGAGGTGACCGATGAGGTTTCCGACATCCG
GCTGCTGCTGTCTCCGCTCGCTCCGGAGGATGTGCGCACGGTCCGGTGTCTGGGCCTCAACTACGCCCTGCATGCGAAGG
AGGTGAGAAGAAGCCGAGGTGCTGCATATGCCTGTAATGCTGACCGGTAGTAGTCGGGCATGGCGCTGCCCAAGTTCCCG
GTCTTGTTCGTACGTGTCCCCCTGCCGATGGACGGAGATGCCGATGTGGCCGGCTGACAGCAGGACAACAGTACAAGCCA
GGCACGTCTCTGAGCGGTCCGACAGACCCGATCCCGGTGCACGCGATGGCGCAGAAGGGCGAGGGCCTCGACTACGAGTG
CGAGCTGGTGATTGTGATTGGCAAAAAGTGCGCCGACGTGACGGAGGCTAACGCGCTCGATCACGTGCTCGGCTATGCCG
TCGGCGACGACGTCTCGCACCGCGAGTGGCAGATCAAGCTCGGCGGCGGCCAGTGGTCGCTCGGCAAGGGCTTCGACGGC
TGGGCGCCGTGGGGACCCGGCATCGTCAGCACCAGGCTCATCCCCGACCCGCAGACGCTCGCGATCTCGACGAAGCTCAA
CGGCCAGGTCGTGCAGGACAGCAACACGTCCGACATGATCTTCAACGTCCGCAAGACCATTGCCTTTCTGAGCCAGGGCA
CCACCCTCCTGCCGGGCGACGTGATCTTTACCGGAACGTATGTGCAGGCCCCCCCCCAGACCGTCTTCCGATGTAGCCAT
GATGCTGACAGCGAGGGACAGGCCGTCGGGTGTTGGCATGGGCCGGAAGCCACAGCTCTGGCTCAAGGACGGAGACGTGG
TGGAGGTGTCGCTCGAGAATGTCGGCACCTGCACCAACAAGGTCGAGTTTTCCTCCAGAGATGTCGCCAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62